SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bowtie index files jay2008 Bioinformatics 0 08-20-2011 06:17 PM
samtools vs picard index pallo Bioinformatics 1 04-11-2011 03:59 PM
Bowtie Index Files zun Bioinformatics 0 10-21-2010 06:55 PM
picard markduplicates on huge files rcorbett Bioinformatics 2 09-17-2010 04:39 AM
Multiple index files in Bowtie? spb2003 Bioinformatics 3 10-13-2009 04:22 PM

Reply
 
Thread Tools
Old 02-12-2011, 08:32 PM   #1
muzz56
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 14
Default How to get index files using picard

Hi,
Am new to this and just reading manuals to get some work done quickly. Am trying to generate an index file to use with Scripture using picard-tools but am getting an error that I don't understand. Does anyone have a clue what am missing here. The error is below:

/Data/RNA_seq$ java -jar /home/mh/Data/seq/picard-tools-1.36/SortSam.jar I=GSM520_ES.aligned.sam O=GSM520.sorted.sam SO=coordinate
[Sat Feb 12 23:29:02 EST 2011] net.sf.picard.sam.SortSam INPUT=GSM520_ES.aligned.sam OUTPUT=GSM520.sam SORT_ORDER=unsorted TMP_DIR=/tmp/mh VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Sat Feb 12 23:29:02 EST 2011] net.sf.picard.sam.SortSam done.
Runtime.totalMemory()=252379136
Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. Empty sequence dictionary.; Line 1
Line: SL-XAS:8:97:1621:1389#0 0 chr1 3044508 0 76M * 0 0 AGAGCGCATAGCCCAAGCCTTACCACTCCCACTATTCGGCCATTTCCCTTATATGAAAGAGGAGCGAGGACCTTCC abab`b`abaaa^`aab`ababaYa`aa_Za_aaaa`aa^_aaaa_]ZbaabXbbV\Wb_aa\a]aUa_^\VV\_W NM:i:0
at net.sf.samtools.SAMTextReader.reportErrorParsingLine(SAMTextReader.java:220)
at net.sf.samtools.SAMTextReader.access$500(SAMTextReader.java:40)
at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:424)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:268)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:240)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:612)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:590)
at net.sf.picard.sam.SortSam.doWork(SortSam.java:58)
at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:156)
at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:117)
at net.sf.picard.sam.SortSam.main(SortSam.java:66)
Thanks
muzz56 is offline   Reply With Quote
Old 02-12-2011, 09:31 PM   #2
jstjohn
Member
 
Location: San Francisco, CA

Join Date: Jun 2010
Posts: 35
Default

It looks like the error is complaining about not finding a "sequence dictionary" in your sam file. Here is something to try, not sure if it will work:

First run CreateSequenceDictionary.jar which outputs a SAM file with just the sequence dictionary given a reference sequence.

Next run MergeSamFiles.jar to merge the above sam file with a sequence dictionary with the original sam file which looks like it is missing a sequence dictionary.

Now maybe SortSam.jar will work on the merged file?
jstjohn is offline   Reply With Quote
Old 02-13-2011, 06:40 PM   #3
muzz56
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 14
Default

Thanks. However that doesn't seem to solve the problem. Anything else I can try?
muzz56 is offline   Reply With Quote
Old 02-13-2011, 08:58 PM   #4
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

You probably don't have a header in your SAM file. Tell me what "samtools view -SH GSM520_ES.aligned.sam" outputs.
nilshomer is offline   Reply With Quote
Old 02-14-2011, 03:44 AM   #5
muzz56
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 14
Default

I was probably quick to declare failure. I've just looked at the merge file output and its empty. Tried running the mergesam again and there's an error there "dictionaries are not of the same size (0, 34)". Am still scratching my head to see where this is from and how to solve it. Any ideas will be appreciated.
muzz56 is offline   Reply With Quote
Old 02-14-2011, 03:39 PM   #6
muzz56
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 14
Default

I sorted out the problem and it's now working just fine. Thanks for your help
muzz56 is offline   Reply With Quote
Old 02-28-2011, 07:08 AM   #7
Graham Etherington
Member
 
Location: Norwich, England.

Join Date: Apr 2010
Posts: 22
Default

Quote:
Originally Posted by muzz56 View Post
I sorted out the problem and it's now working just fine. Thanks for your help
Would you care to share your solution so that people searching for this problem have a possible answer.
Graham Etherington is offline   Reply With Quote
Old 03-10-2011, 11:54 AM   #8
polarise
Member
 
Location: Ireland

Join Date: Jan 2011
Posts: 13
Default Can Someone Verify This Solution?

1. Create the dictionary, say, dict.sam
java -jar CreateSequenceDictionary.jar OUTPUT=dict.sam R=ref.fa

2. Create a new file (unsorted_file.sam) that has both the dictionary and the aligned reads.
cat dictionary.sam > unsorted_file.sam && cat file.sam >> unsorted_file.sam

3. Sort the SAM file
java -jar SortSam.jar INPUT=unsorted_file.sam OUTPUT=sorted_file.sam SO=coordinate

That's what has worked for me.

P.K.
polarise is offline   Reply With Quote
Old 10-31-2011, 01:57 PM   #9
azroger
Junior Member
 
Location: Tucson, AZ

Join Date: Oct 2010
Posts: 7
Default

This worked for me as described above verbatim.

It did not work for me when I tried this:
java -jar CreateSequenceDictionary.jar OUTPUT=dict.sam R=references_directory/ref.fas

I copied my reference file to the same directory and changed the ending to .fa. I'm not sure which (or both changes) were important. Thanks for the help!
azroger is offline   Reply With Quote
Old 09-30-2014, 05:04 PM   #10
Shani_A
Junior Member
 
Location: Australia

Join Date: Sep 2014
Posts: 1
Default change .fas to .fa

I think it is a matter of simply changing the .fas to .fa . I tried it a while ago, and .fas gives an error but .fa created the dict file smoothly.
Shani_A is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:17 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO