SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimming adapters with Cutadapt Elfangor RNA Sequencing 3 08-10-2016 11:26 AM
cutadapt trimming for multiple files lianov Bioinformatics 13 11-14-2015 02:11 AM
Adapter trimming with cutadapt Kulvait Bioinformatics 3 05-05-2015 03:48 AM
3' trimming using cutadapt changes property of 5'. Alex Lee RNA Sequencing 0 04-17-2014 10:28 PM
Adapters trimming: Cutadapt vs Trimmomatic MafaldaSF Bioinformatics 8 03-20-2014 06:16 AM

Reply
 
Thread Tools
Old 04-21-2017, 04:41 AM   #1
Bernadeta
Junior Member
 
Location: Oxford

Join Date: May 2016
Posts: 2
Default Cutadapt trimming issues

Hi, perhaps someone could advise me on the following issue.

I was trimming my paired-end reads with cut adapt using the following command:
Code:
cutadapt  -a CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --minimum-length 45 -o ~/Virus_S5_trimmed_min45_R1.fastq.gz -p ~/Virus_S5_trimmed_min45_R2.fastq.gz Virus_S5_R1.fastq.gz Virus_S5_R2.fastq.gz
I the ran FastQC for the trimmed reads and in the overrepresented sequences section for the read 2 I have sequences all of which contain ATTGATGGTGCCTACAG in their 5' followed by different gene sequences.

This sequence is from one of the adaptors (I underlined it in the code), but I don't understand why does the cutadapt not trimm it off.

Any help would be appreciated.
Bernadeta is offline   Reply With Quote
Reply

Tags
cutadapt, fastqc, trimming reads

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:25 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO