Hi everyone,
It is my first time posting on this forum. I was wondering if someone has mixed libraries prepared using Nextera XT and TruSeq LT in a single pair-end MiSeq run. Although Illumina's official answer is that they do not recommend it, tech support says that other people are doing it successfully.
This is my first time doing it and I have a couple of questions:
- I have been looking at the Nextera tagmetation reads/adapters and comparing them to the Illumina TruSeq reads. Do both sets of primers come in the reagent cartridge? I don't see how they can be sequenced with the same primers.... am I missing something?
According to Illumina the sequence of the adapters is
Nextera Transposase Adapters
Read 1
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read 2
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Nextera Index Kit – PCR Primers
Index 1 Read
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Index 2 Read
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
The TruSeq adapter/spacer sequences are
Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
- From the setup, I understand that the Nextera i7 barcodes are sequenced at the same time than the Truseq 6-base barcodes. Are there any incompatibility issues with the i7 indexes and the Truseq indexes that will prevent me from demultiplexing correctly when I get my sequences back? How many base pairs have to be different in order for us to differentiate the reads from one another?
- The libraries prepared with Nextera have a wider range of fragments (a wider area under the curve as per bioanalyzer) as well as a smaller average insert size than the libraries prepared with the TruSeq kit. I understand that there is a bias towards smaller fragments binding to the flow cell that will be reflected on the coverage per library. Is there a way to correct for that before pooling?
Thanks you all so much for your help!
Carolina
It is my first time posting on this forum. I was wondering if someone has mixed libraries prepared using Nextera XT and TruSeq LT in a single pair-end MiSeq run. Although Illumina's official answer is that they do not recommend it, tech support says that other people are doing it successfully.
This is my first time doing it and I have a couple of questions:
- I have been looking at the Nextera tagmetation reads/adapters and comparing them to the Illumina TruSeq reads. Do both sets of primers come in the reagent cartridge? I don't see how they can be sequenced with the same primers.... am I missing something?
According to Illumina the sequence of the adapters is
Nextera Transposase Adapters
Read 1
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read 2
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Nextera Index Kit – PCR Primers
Index 1 Read
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Index 2 Read
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
The TruSeq adapter/spacer sequences are
Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
- From the setup, I understand that the Nextera i7 barcodes are sequenced at the same time than the Truseq 6-base barcodes. Are there any incompatibility issues with the i7 indexes and the Truseq indexes that will prevent me from demultiplexing correctly when I get my sequences back? How many base pairs have to be different in order for us to differentiate the reads from one another?
- The libraries prepared with Nextera have a wider range of fragments (a wider area under the curve as per bioanalyzer) as well as a smaller average insert size than the libraries prepared with the TruSeq kit. I understand that there is a bias towards smaller fragments binding to the flow cell that will be reflected on the coverage per library. Is there a way to correct for that before pooling?
Thanks you all so much for your help!
Carolina
Comment