SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Rescuing stopped MiSeq run yaximik Illumina/Solexa 9 09-20-2018 08:22 AM
MiSeq stopped run yaximik Illumina/Solexa 20 03-18-2013 08:10 AM
How much PhiX in MiSeq run? thdybwf Illumina/Solexa 1 11-26-2012 04:01 AM
Worst MiSeq Run ever? pmiguel Illumina/Solexa 0 04-30-2012 05:54 AM
Has Anyone stopped a HiSeq run due to low intensity clusters? ashchin Illumina/Solexa 10 01-25-2011 04:03 PM

Reply
 
Thread Tools
Old 03-06-2013, 01:29 PM   #1
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default Stopped MiSeq run

Hi,
I experienced first problems with our MiSeq. This morning with new run loaded there was a flow rate error - first thought, valve.....
Did re-test at 250ul (failed) and 500ul (machine freezed) so had to restart. While restart I re-seated the flow cell and I managed to pass the flow rate check (no other issues). After 1h run stopped - error msg that was thrown is related to "no clusters detected". We managed to do couple runs on it with no problems (300 cycle / 500 cycle / nano and regulars). This is updated v2 version (with recently updated software).
Is this a prelude to valve problems (already reported in our collaborators lab) ?
Thanks!
memento is offline   Reply With Quote
Old 03-06-2013, 01:39 PM   #2
kwaraska
Senior Member
 
Location: Boston,MA

Join Date: Nov 2008
Posts: 121
Default

A no cluster error is thrown when there is nothing to see OR a sample with no diversity. If it sees all the same base at each position for the first 5 bases, it assumes everything is junk and will stop the run.

I know this because it happened to me. When we spoke to the customer (we are a core) they told us there was no diversity on the first 10 or so bases. When we reran with a PhiX spike in-no problem.
kwaraska is offline   Reply With Quote
Old 03-06-2013, 01:50 PM   #3
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

There was big diversity of the amplicons sequenced (more than 300 totally different ones) plus some phix... Thanks for a quick reply!
memento is offline   Reply With Quote
Old 03-06-2013, 05:29 PM   #4
kcchan
Senior Member
 
Location: USA

Join Date: Jul 2012
Posts: 182
Default

Were you using the correct sequencing primers for your amplicons? That would also give you a no clusters error message.

MiSeq v2 has a newly designed valve, so it shouldn't have the same problems the earlier instruments experienced.
kcchan is offline   Reply With Quote
Old 03-06-2013, 07:17 PM   #5
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

kcchan,

I checked the setting under sample sheet. last 3 runs (successful!) I had a different "adapter" sequence in my sample sheet csv - would that cause that??
memento is offline   Reply With Quote
Old 03-07-2013, 04:32 AM   #6
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,800
Default

I suppose you have already contacted Illumina tech support/local FAS. If there is something wrong with your MiSeq hardware then none of us are going to be of much help.
GenoMax is offline   Reply With Quote
Old 03-07-2013, 10:02 AM   #7
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

Techsup asked me to run few tests. Volume test failed on PR2 sipper....I guess no wonder there was nothing detected if the incorporation buffer didnt find its way to a flow cell...
looks like hardware.
are they any fast with repairs ?
thanks!
memento is offline   Reply With Quote
Old 03-07-2013, 10:21 AM   #8
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,355
Default

PR2 sipper fails often and is not a cause for concern.

Did it make any images? I'm sure tech support will ask for your MCS and cycle logs...but you can poke around in there to see what the error might be (searching for "ERR:" is most helpful.
ECO is offline   Reply With Quote
Old 03-07-2013, 10:24 AM   #9
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

MCS was not able to eastablish focus model as the result of low intensity...
they also said that PR2 is a common issue and not a real problem...
memento is offline   Reply With Quote
Old 03-07-2013, 10:35 AM   #10
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

I used these primers to enrich my library:
Forward:
aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttc
reverse:
caagcagaagacggcatacgagatcggtctcggcattcctgctgaacc
memento is offline   Reply With Quote
Old 03-07-2013, 12:18 PM   #11
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

what is more interesting. If I used i7 barcode (index1):
Reverse primer used to enrich:
caagcagaagacggcatacgagatCCTGCGAcggtctcggcattcctgctgaacc

Do I have to use custom index1 primer to read it or the MiSeq flow cell primer will work with this ?
THanks!
memento is offline   Reply With Quote
Old 06-10-2013, 12:53 AM   #12
MLog
Member
 
Location: Russia

Join Date: Jan 2010
Posts: 36
Default

Hi memento,

have you found what was the reason of failed run? Was this an instrument issue or rather reagents/library?
I'm asking because I got the same error from our Miseq last week. If this is a reagent issue, I would like to retry with a new kit. The samples need to be sequenced quite urgently.
MLog is offline   Reply With Quote
Old 06-10-2013, 07:51 AM   #13
memento
Member
 
Location: UK

Join Date: Nov 2010
Posts: 49
Default

@ MLog
When this problem arises, usually the flow cell is not seated properly. You have to open the flow cell compartment and re-seat the flow cell. If there was a spill all over the flow cell, You should clean the flow cell first. At that particular problem this helped.
Just now, after illumina replaced our v1 valve to v3 valve I experienced the same problem. This time though, re-seating the flow cell didnt help...illumina tech is coming today to help...
You can keep the reagents @ 2-8C for ~ 1 week. Flow cell should be intact (unless it is a flowcell's gasket that caused flow-rate error).
memento is offline   Reply With Quote
Old 06-13-2013, 11:33 AM   #14
MLog
Member
 
Location: Russia

Join Date: Jan 2010
Posts: 36
Default

I checked the flowcell, it looked perfectly OK and was delivering proper volumes of water during washes. So we retried with another kit and it worked without any problems. Looks like this no clusters error might be a reagent issue, too.
MLog is offline   Reply With Quote
Old 01-12-2015, 07:27 PM   #15
d00b
Member
 
Location: CA

Join Date: Jan 2009
Posts: 17
Default Your flowcell problem

This is flowcell issue. the inlet of the gasket was not well aligned to the injector port. it will make this kind of error. you need to request replacement for the reaction kit and other supply material for index library prep.
d00b is offline   Reply With Quote
Old 01-20-2015, 10:36 PM   #16
d00b
Member
 
Location: CA

Join Date: Jan 2009
Posts: 17
Default

we used exactly same PAL (stopped running) for next new running and it works well. This indicates the PAL is not a problem. it is fluidics.. illumina techsupport said "Miseq should have alert before start running, if there is flow cell problem."

But I don't think, the fluid is delivered from sample load tube by sipper 17 (miseq cartridge in position 17) for flow rate testing. if the fluid tube or sipper has air bubble or dust, the PAL sample won't be able to deliver to the flow cell chamber. It will lead to stop the premature running.


Last edited by d00b; 01-22-2015 at 04:27 PM.
d00b is offline   Reply With Quote
Old 01-22-2015, 04:02 PM   #17
Yepler
Member
 
Location: Tucson, AZ, USA

Join Date: Oct 2010
Posts: 22
Default

Hmmm, one other thing to check is whether the flow cell is all snapped together. I had the same issue (unable to focus - probably because there was nothing to focus on), and the flow cell housing was loose. I get kits about 20 at a time, and about 2/3rds of the flowcells in that batch had plastic housings that weren't fully snapped together.

Sometimes these will just throw the pre-check error, but other times it will go through the precheck and then fail at focusing.

Illumina did replace my kit when the run failed; I just check the housing carefully now.

This may have nothing to do with what you're seeing, but it's something to check.

Cheers-
Deb
Yepler is offline   Reply With Quote
Old 10-27-2015, 07:08 PM   #18
GA-J
Member
 
Location: USA

Join Date: Jul 2015
Posts: 28
Default

I had a stopped miseq run, 2x300, it stopped at 546 cycle. Run completed with error message: best focus is too near edge to the range.So no fastq files generated. Anyone knows what cause this stopping? The cluster density is 1156k/mm^2,Q30 and pass filter both good. I did the miseq system check, everything passed, I started a rerun, almost same. But I worry it may stop again. Should I worry??

Last edited by GA-J; 10-27-2015 at 07:17 PM.
GA-J is offline   Reply With Quote
Old 10-27-2015, 08:59 PM   #19
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,187
Default

It could be due to overclustering. Look at page 3 for details in the following doc:

http://support.illumina.com/content/...0-2014-038.pdf
nucacidhunter is offline   Reply With Quote
Old 10-28-2015, 08:58 AM   #20
bunce
Member
 
Location: Perth

Join Date: Sep 2012
Posts: 55
Default

Hi GA-J, Are you sequencing amplicons? - you can attempt to salvage the data by altering the sample sheet to do 300 in read 1 and then~240 for R2 (you do this in MiSeq reporter - http://localhost:8042). And then re-queue the run analysis.It may output the fast files you are after. The quality issues in R2 for 600 cycle kits are well documented - you might want to let Illumina know - your kit may be in the batch that they will replace? good luck....
bunce is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:29 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO