SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 11:52 AM
Miseq FASTQ sequence identifier missing index read? rnaeye Illumina/Solexa 17 05-25-2015 12:21 PM
Miseq illumina primer rozitaa General 1 06-04-2013 03:02 AM
Alternative index primer Andrew_Slatter Illumina/Solexa 8 02-16-2011 10:39 AM
Query about modification of PCR primer index? fusu Illumina/Solexa 0 02-23-2010 08:46 PM

Reply
 
Thread Tools
Old 12-24-2013, 10:47 PM   #1
krispy
Junior Member
 
Location: Singapore

Join Date: Apr 2013
Posts: 7
Default MiSeq Index Primer Sequence

Hi all,

I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?

5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and probably provide me if there is any reliable source where Illumina confirms this is the correct sequence?

Thank you very much.
Merry Christmas.
krispy is offline   Reply With Quote
Old 12-24-2013, 11:51 PM   #2
gringer
David Eccles (gringer)
 
Location: Wellington, New Zealand

Join Date: May 2011
Posts: 838
Default

You mean these sequences?

http://supportres.illumina.com/docum...enceletter.pdf
gringer is offline   Reply With Quote
Old 12-25-2013, 12:10 AM   #3
krispy
Junior Member
 
Location: Singapore

Join Date: Apr 2013
Posts: 7
Default

Thanks for the reply.

I actually got the sequence from the customer letter too (here in: oligonucleotide sequences for the multiplexing sample prep oligo only kit - multiplexing index read sequencing primer).

but may I know is there somewhere stated that this is also the MiSeq Index Primer that comes together with the kit? I wish to synthesize the same primer but load it as custom index primer in different well, I am kinda sure the sequence I got above will work as a custom index primer too even it's not the same with the default one (because it will be run as custom anyway), but I was given a "task" to find out the exact MiSeq default index primer.
krispy is offline   Reply With Quote
Old 12-26-2013, 02:31 AM   #4
gringer
David Eccles (gringer)
 
Location: Wellington, New Zealand

Join Date: May 2011
Posts: 838
Default

MiSeq uses TruSeq and Nextera kits, so I expect that the TruSeq/Nextera primer sequences used in that document are the correct ones. You would probably need to contact Illumina to confirm that (info@illumina.com, or customerservice@illumina.com).
gringer is offline   Reply With Quote
Reply

Tags
index, index primer, miseq, primer

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:31 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO