small RNA Adapter

[suludana]

Hi,

could anyone confirm me that the adapter sequence we should remove from the small RNA reads, before the analysis, is:

5’-TCGTATGCCGTCTTCTGCTTG-3’

Thank you very much.

[francois.sabot]

Check this page, containing all the Solexa adapters:

http://intron.ccam.uchc.edu/groups/tgcore/wiki/013c0/Solexa_Library_Primer_Sequences.html

[suludana]

Thank you François.

I know this list. The point is that I have some dificulties to understand which is the adapter I will find in the final of the reads.

[NicoBxl]

it's the 3' prime adapter . So this one is the good one

[suludana]

Thanks Niko!

[suludana]

Uppps, it seems there is an update for v1.5:

ATCTCGTATGCCGTCTTCTGCTTG