HI,
I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings
AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% over 30bp)
I checked my reads and found that this 50bp sequence locates on 5' of my reads that account 0.25% of all reads. (also some of my reads that there are GCGCA/GCTCAG/AACCG/AACAAAAGG sequence before this 50bp sequence too))
Since my reads are all 88bp length. I do not want to keep these reads even if I cut these 50bp sequence off.
Anyone know if there is any tools that can get rid of these reads who contain this 50bp sequence in the read? Or anyone has scripts or other ways to do this?
I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings
AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% over 30bp)
I checked my reads and found that this 50bp sequence locates on 5' of my reads that account 0.25% of all reads. (also some of my reads that there are GCGCA/GCTCAG/AACCG/AACAAAAGG sequence before this 50bp sequence too))
Since my reads are all 88bp length. I do not want to keep these reads even if I cut these 50bp sequence off.
Anyone know if there is any tools that can get rid of these reads who contain this 50bp sequence in the read? Or anyone has scripts or other ways to do this?
Comment