Hello, I am getting these errors when running soapsnp (infact I am running crossbow and it is in turn running soapsnp) . Any help would be appreciated.
Code:
* reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,543 * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,801 * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1311 * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4704 * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2678 * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,568 * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,747 * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1326 * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4748 * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2607 * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,549 * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,778 * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1347 * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4565 * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2762 * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,594 * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,740 * Read the last line of input * reporter:counter:SOAPsnp wrapper,Ranges processed,1 * reporter:counter:SOAPsnp wrapper,Alignments processed,761653 * Soapsnp.pl: Genotyping chromosome 0 3000000-4000000 using 761653 alignments: Wed Feb 22 17:33:29 IST 2012 * Soapsnp.pl: chromosome 0 is haploid; using args "-r 0.0001 -m" * Soapsnp.pl: head -4 .tmp.1000000.0003: * 0 0003 002999964 + GATGTTTAAGGCGCGGTCAGCATTTCCAGATCGCTA IAIAIIIIIGIII9'I<./7&/DII".+(%'#&"%' 0 33:A>C 0 r * 0 0003 002999965 + ATGTTTAAGGCGCGGTCAGCATTTCCAGATCGTTCC IIIIIIIIIIIIIIIID1IE6III)0"+'/*%"("% 0 32:A>T,34:A>C,35:A>C 0 r * 0 0003 002999967 - GTGGAAGGCGCGGTAAGCATTTCCAGATCGATAAGC &)"#&%&&"#'&-6%'*(6I-79=IC@IIIIIIIII 0 21:C>A,32:T>G,33:T>G 0 r * 0 0003 002999968 - TAAAAGGCGCGGTCATCATTTCCAGATCGATAAGCC "#$"+""&#+%#($*#%+,*,%(;-00.F?3II:I7 0 20:G>T,33:T>A,34:T>A 0 r * Soapsnp.pl: tail -4 .tmp.1000000.0003: * 0 0003 003999994 + CTGGATCTTCTTTGCCCAGCGCCGCCGGACCGTTTT IIIIIIIIIIIIIIIIII4:I8I-<%A"#$$-%)'$ 0 25:A>C,28:G>A,29:A>C,32:A>T,35:G>T 0 r * 0 0003 003999996 + GGATCTTCTTTGCCCAGCGCCGCAGGTTCGGTTTCG IICIIIIIIIIAIII2II=G<II+10""))",$%"$ 0 26:G>T,27:A>T,30:A>G,33:G>T,34:A>C 0 r * 0 0003 003999999 + TCTTCTTTGCCCAGCGCCGCCGGCACGATTGAGAGT @@II8IIHCI266I&46*3/"/#"('*#)#$"""&% 0 20:A>C,23:G>C,34:A>G,35:G>T 0 r * 0 0003 003999999 - TGAGCTATGACCAGCGCCGCAGGAACGATTGAGAAG """#&"#""&3$-&=%0I=II>IIIIAI+9IIIIII 0 12:G>A,26:C>A,29:T>A,32:T>G,33:T>A,34:C>G 0 r * reporter:counter:SOAPsnp wrapper,SNP files missing,1 * Soapsnp.pl: Warning: /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/0.snps doesn't exist * Soapsnp.pl: ls -l /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps * Soapsnp.pl: total 0 * Soapsnp.pl: Warning: neither /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/chr0.snps nor /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/0.snps exist; not using known SNPs * Soapsnp.pl: ls -al /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps * Soapsnp.pl: total 8 * drwxr-xr-x 2 xyzuser hadoop 4096 2012-02-22 09:36 . * drwxr-xr-x 6 xyzuser hadoop 4096 2012-02-22 09:36 .. * Soapsnp.pl: /home/xyzuser//cbexec/bin/linux32/soapsnp -i .tmp.1000000.0003 -d /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa -o .tmp.snps -z '!' -L 36 -c -H -T .range_3000000_4000000 -r 0.0001 -m -2 -u -n -q >.soapsnp.14632.stdout 2>.soapsnp.14632.stderr * Soapsnp.pl: soapsnp returned 33792 * Soapsnp.pl: command: /home/xyzuser//cbexec/bin/linux32/soapsnp -i .tmp.1000000.0003 -d /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa -o .tmp.snps -z '!' -L 36 -c -H -T .range_3000000_4000000 -r 0.0001 -m -2 -u -n -q >.soapsnp.14632.stdout 2>.soapsnp.14632.stderr * Soapsnp.pl: stdout from soapsnp: * Soapsnp.pl: stderr from soapsnp: * -i is set to .tmp.1000000.0003 * -d is set to /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa * -o is set to .tmp.snps * Standard Fastq System Set * -L is set to 36 * -c is set * -T is set to .range_3000000_4000000 * -r is set to 0.0001 * -m is set * -2 is set * -u is set * -n is set * -q is set * Read 5498450 from 78551 lines of input FASTA sequence 17:33:29 * Finished loading and binarizing chromosome 17:33:29 * Finished parsing 0 known SNPs 17:33:29 * Reading Chromosome and dbSNP information Done. * Read target region done. * Training correction matrix in Crossbow format17:33:30 * Correction Matrix Done 17:33:38 * Illegal instruction * Soapsnp.pl: range: 0 3000000 4000000 * Soapsnp.pl: head -4 .tmp.snps: * Soapsnp.pl: tail -4 .tmp.snps: * Dying following soapsnp returning non-zero 33792 at /home/xyzuser//cbexec/Soapsnp.pl line 372. ****** Fatal error 1.1.2:R330: Aborting because child with PID 14405 exited abnormally When requesting support, please include the full output printed here. If a child process was the cause of the error, the output should include the relevant error message from the child's error log. You may be asked to provide additional files as well. Non-zero exitlevel from SNP calling stage