SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SOAP alignment format convert to SAM/BAM KevinLam Bioinformatics 31 01-10-2018 08:05 PM
SAM/BAM format to wiggle format pinki999 Bioinformatics 19 08-12-2015 12:35 AM
SAM to CUFFLINKS SAM format repinementer Bioinformatics 4 03-15-2012 08:53 AM
Looking process to convert gff3 format into ace format or sam format andylai Bioinformatics 1 05-17-2011 02:09 AM
anyone help me on bowtie format -> sam format! tninja Bioinformatics 2 04-25-2010 09:33 PM

Reply
 
Thread Tools
Old 07-01-2010, 12:22 AM   #241
KevinLam
Senior Member
 
Location: SEA

Join Date: Nov 2009
Posts: 198
Default

Quote:
Originally Posted by win804 View Post
Thanks Li Heng. I just want to confirm that nothing is wrong with the sorted bam file.

Thanks a lot.
You may convert to sam and count the lines as a proxy for checking.
but yes as lh3 mentioned sorted files compress better due to the compression algorithm
KevinLam is offline   Reply With Quote
Old 07-01-2010, 12:27 AM   #242
KevinLam
Senior Member
 
Location: SEA

Join Date: Nov 2009
Posts: 198
Default

There was a discussion on how the CS tag should be generated in sam files according to the specs. Is there a consensus on how it is to be done?

I have to write a script to append the CS tag info to the BWA alignment of SOLID reads. I am hoping to make it as painless as possible.
KevinLam is offline   Reply With Quote
Old 08-04-2010, 09:02 PM   #243
bosTau2
Member
 
Location: Antwerp, BE or Cambrigde, UK

Join Date: Nov 2008
Posts: 12
Default

Is there sam2maq (sam to maq map format)? I am testing simulated data and like to convert ssaha2 alignment to maq output so that I can analyze them in maq. I cerated all the simu data in maq.
Thank you.
bosTau2 is offline   Reply With Quote
Old 08-22-2010, 03:06 PM   #244
wuhoucdc
Member
 
Location: Nashville

Join Date: Oct 2009
Posts: 14
Default

Dear All,

Do you know if samtools can perform multiple commands (>2) together? Here assuming that I have ten BAM files (result001.bam, result002.bam,......result010.bam) and want to merge them first and then sort and index them, the last step I hope is to extract the data for chromosome 1 (chr1), how can I edit the samtools command? I did it like this:
samtools merge result.bam result001.bam result002.bam ............result010.bam |\
samtools sort - result | \
samtools index result.bam | \
samtools view result.bam chr1 > resultchr1.bam

Is it right?

Thank you very much!

Wu
wuhoucdc is offline   Reply With Quote
Old 08-24-2010, 12:43 PM   #245
sbaheti
Member
 
Location: Rochester

Join Date: Jul 2010
Posts: 12
Default

Hi lh3

Originally Posted by xguo
I got a list of candidate SNPs using BWA and samtools for RNASeq data, and am trying to weigh various filtering options. "samtools.pl varFilter" gives a list of filtering criterion with default setting. The maximum read depth is set at 100. Given that duplicate reads have been removed by "samtools rmdup", do I still need to limit the maximum read depth?

replied by lh3:
Yes, you need this unless you are doing target sequencing in which case the read depth is expected to vary a lot.

My question

If we are doing variant calling in exome capture analysis, do i need to limit the max read depth when using samtool varFilter tool?
sbaheti is offline   Reply With Quote
Old 08-24-2010, 10:30 PM   #246
bosTau2
Member
 
Location: Antwerp, BE or Cambrigde, UK

Join Date: Nov 2008
Posts: 12
Default

It depends on regions. If a region is repetitive then you need to filter out possible duplications which can cause artificial hetero SNPs. "Repetitive" here means kmer uniqueness --- how many times a given kmer (30mer for example) can be found in a reference.
bosTau2 is offline   Reply With Quote
Old 09-03-2010, 02:09 PM   #247
aby
Member
 
Location: New Delhi

Join Date: Sep 2010
Posts: 12
Default

I was trying to convert my single read illumina file to SAM format using the export2sam.pl script. It does not work and gives the following error:

Use of uninitialized value $t[21] in string ne at export2sam.pl line 67, <$fh1> line 14063.

Here is a sample data from my file.

HWUSI-EAS174_0025:2:1:5:488#0/1:CGGAGAATACGCTCCCATTCCCCCNGNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTGATCTTAGATCGGA:aabbbbb_baaa_a]ab`_aBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
HWUSI-EAS174_0025:2:1:5:1542#0/1:TGGATGCCTAGGCAATCAGAGGCGNANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGTGATAAGCAGCGAA:abbbabbbbbbbbbbbbbbbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB


How do I resolve it ? Is there any other way?

A.
aby is offline   Reply With Quote
Old 09-03-2010, 02:46 PM   #248
aby
Member
 
Location: New Delhi

Join Date: Sep 2010
Posts: 12
Default

I converted the all.map file generated from MAQ tool to SAM format using maq2sam-long in samtools. The output file I named as Out. Now when I try to convert Out file (which is in SAM format) to BAM format using the command
samtools view -S Out

I get an error message that header @ not found. When I edit the Out file by manually adding @ at the top, more errors appear. What should I do? Is there a fault in the SAM file generated by the converter maq2sam ? Is there any other way to convert SAM file to BAM file? I tried 'samtool import' and that also does not work.
aby is offline   Reply With Quote
Old 09-06-2010, 03:21 AM   #249
NF_seq
Junior Member
 
Location: Beijing, China

Join Date: Jun 2010
Posts: 2
Unhappy

Quote:
Originally Posted by NSTbioinformatics View Post
Question about the output of bwa?

I got the output, see below:
HWI-EAS307:1:54:758:902#0 20 19641_CLSZ1904.b1_P20.ab1_CLSZ_L._sativa_library_forward_335 301 20 36M * 0 0 CAAATCGGTGTGTTTTCACTGGTCGTGCTCGTTCCG aabaaaaaaaaababaa`aaaabaabaabbabaaaa XT:A:U NM:i:1 X0:i:1 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:35T0 XA:Z:13134_QGB27J17.yg.ab1_QGB_L._sativa_library_forward_448,-58,36M,2;7061_CLS_S3_Contig6993_CLS_S3_L._sativa_library_forward_968,-404,36M,2;

I can not understand the flag value 20. I used "samse" to process single reads.
"XT:A:U" indicates the read uniquely mapped to the reference, why i still got XA for alternative alignment inforamtion?
It is confused me. Someone could help me a bit for that? Thank you very much
It's also confused me that "XT:A:U" and "XA:..." information came up in one alignment. Could anyone please explain that? Thanks a lot! And if i only care about uniquely mapped reads, is this kind of reads what i want?
NF_seq is offline   Reply With Quote
Old 09-07-2010, 09:57 AM   #250
aby
Member
 
Location: New Delhi

Join Date: Sep 2010
Posts: 12
Default sam to bam conversion not taking place

samtools import example.sam example.bam

This command does not work. Gives error:

Usage: bamtk import <in.ref_list> <in.sam> <out.bam>


What to do? What is in.ref_list ?
aby is offline   Reply With Quote
Old 09-07-2010, 10:55 AM   #251
AXW
Junior Member
 
Location: United States

Join Date: Sep 2010
Posts: 3
Default

Does anybody know of a utility/script for converting .SAM/BAM files into .SOAP? I know that there are scripts out there to go from SOAP->SAM, but I can't find anything going the other way.

Cheers.
AXW is offline   Reply With Quote
Old 09-08-2010, 09:58 AM   #252
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

Quote:
Originally Posted by aby View Post
samtools import example.sam example.bam

This command does not work. Gives error:

Usage: bamtk import <in.ref_list> <in.sam> <out.bam>


What to do? What is in.ref_list ?
Use faidx to make a .fai file, use that for the in.ref.list. It works for me.
swbarnes2 is offline   Reply With Quote
Old 09-09-2010, 01:18 AM   #253
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Hi Heng,

Can you please explain about the new feature of samtools (ie) multisample pile up? Thanks.
seq_GA is offline   Reply With Quote
Old 09-09-2010, 05:19 AM   #254
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

http://samtools.sourceforge.net/mpileup.shtml
lh3 is offline   Reply With Quote
Old 09-09-2010, 06:37 AM   #255
aby
Member
 
Location: New Delhi

Join Date: Sep 2010
Posts: 12
Default

Okay, I have solved my problems. Seems there is a script to add the header file, and different command options for conversion to Bam.
aby is offline   Reply With Quote
Old 09-11-2010, 12:29 AM   #256
corthay
Member
 
Location: japan

Join Date: Oct 2008
Posts: 25
Default

Hi,

I got the following strange pileup results and I am at a loss what to do.
My data is RNA-SEQ and sam file was generated by using Tophat ( ver1.0.14 )
Is there anyone who had similar result or have any idea to solve this problem ?

Thanks
Corthay

-----------------------------------------------------------
Supercontig4 3775441 A A 36 0 60 3 .., EGD
Supercontig4 3775442 A A 36 0 60 3 .., FGC
Supercontig4 3775443 C C 36 0 60 3 .., EGB
Supercontig4 3775444 G G 36 0 60 3 .., FGD
Supercontig4 3775445 G G 36 0 60 3 .., GGD
Supercontig4 3775446 A A 36 0 19 30 ^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G^"G.., G>GCFGEGFGDGGGD>?E=3EEF#BE?AEB
Supercontig4 3775447 A A 117 0 19 30 ............................., G?GCGGEGGGDGGGBCBFB<BBG#?DBEGE
Supercontig4 3775448 G G 36 0 19 30 TTTTTTTTTTTTTTTTTTTTTTTTTTT.., F>G5EDBBEGDFGGBA?D@-B?D#??AEGE
Supercontig4 3775449 A A 36 0 19 30 CCCCCCCCCCCCCCCCCCCCCCCCCCC.., G:GBFGCGGGCGGFECCA:?B5D?BDCEGE
Supercontig4 3775450 A A 36 0 19 30 GGGGGGGGGGGGGGGGGGGGGGGGGGG.., G<G?GGEGGG?GGGDCEB::BAFA@ECBDD
Supercontig4 3775451 T T 36 0 19 30 AAAAAAAAAAAAAAAAAAAAAAAAAAA.., GBGDGGEGGG?GGGEBCDB?:?GA?G?BGA
-----------------------------------------------------------
corthay is offline   Reply With Quote
Old 09-24-2010, 05:54 AM   #257
bioenvisage
Member
 
Location: it

Join Date: Oct 2009
Posts: 40
Default

Hi Ih3,

Is there any utility/script/tool for converting SAM format to SOAP alignment output format.Iam using SOAPsnp which accepts only the SOAP aligner format.
bioenvisage is offline   Reply With Quote
Old 10-20-2010, 03:50 AM   #258
rdeborja
Member
 
Location: Toronto

Join Date: Aug 2008
Posts: 42
Default which script adds the header

Just wondering which script was used to add the header after the maq2sam-long conversion.

Quote:
Originally Posted by aby View Post
Okay, I have solved my problems. Seems there is a script to add the header file, and different command options for conversion to Bam.
rdeborja is offline   Reply With Quote
Old 10-20-2010, 06:15 AM   #259
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

@bioenvisage

I would encourage you to use samtools/gatk/snvmix/varscan. Soapsnp is great but others are as good and easier to use.
lh3 is offline   Reply With Quote
Old 10-22-2010, 03:50 AM   #260
carole_smadja
Junior Member
 
Location: Montpellier

Join Date: Oct 2010
Posts: 5
Default fasta2sam converter

Dear All,

I have generated a mapping assembly in fasta format and I now need to convert it into the sam format accepted by samtools.
Would anybody know a fasta2sam converter I could get access to?

Thank you very much for your assistance.

Carole
carole_smadja is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO