[billstevens]

Yup, it works fine. Additionally, I just tried it with -G but without the

\ --transcriptome-index=transcriptome_data/known \

part and it works. I'm guessing there has to be something wrong with the syntax. The folder is created too, but i keep getting the same error. Any other ideas?

[SilviaBCE]

Hi everybody! I'm new to this forum and to the RNA-seq world so I hope that my questions won't seem too naive to you!
I'm trying to make my first tophat run, I have Illumina paired end reads and I want to align them to the human genome.
I downloaded the pre-built index froma bowtie so I suppose that I don't need to use bowtie-build in this case, do I?
Anyway
this is the code I typed:
$ cd /bowtie/
$ tophat -r 54 --mate-std-dev 35 --solexa1.3-quals hg19 ~/RNA.seq.data/My.data/exp007.s_1_1.fq ~/RNA.seq.data/My.data/exp007.s_1_2.fq



And this is the output with the error message:


[Wed Jun 13 18:08:00 2012] Beginning TopHat run (v1.4.1)
-----------------------------------------------
[Wed Jun 13 18:08:00 2012] Preparing output location ./tophat_out/
[Wed Jun 13 18:08:00 2012] Checking for Bowtie index files
Error: Could not find Bowtie index files hg19.*

What can I do to fix this problem?
Thanks a lot.

[wmyashar]

I am having the same problem but I cannot even get the test_data to run, isn't the bowtie indexes in the same folder that comes from the zip? I have tried reinstalling tophat to make sure I did not mess anything up but it keeps giving me the same error (including the code that i inputted):

Wills-MacBook-Pro:tophat-2.0.3 wmyashar$ tophat2 /Users/wmyashar/Desktop/test_data/ reads_2.fq

[2012-06-15 13:37:18] Beginning TopHat run (v2.0.3)
-----------------------------------------------
[2012-06-15 13:37:18] Checking for Bowtie
Bowtie version: 2.0.0.6
[2012-06-15 13:37:18] Checking for Samtools
Samtools version: 0.1.18.0
[2012-06-15 13:37:18] Checking for Bowtie index files
Error: Could not find Bowtie 2 index files (/Users/wmyashar/Desktop/test_data/.*.bt2)

[Bulak]

For bowtie index problems: make sure to include a slash '/' at the end of the path when you export it in .bashrc
export BOWTIE_INDEXES=/some_full_path/to_bowtie_indexes/
Otherwise, when you run tophat you get missing index messages even though all the index files are properly created.

To billstevens: I had the same problem. One thing I figured is that tophat only checks for the presence of the folder set by --transcriptome-index. If the folder is there, even though content not complete, it does seem to ignore the --GTF flag and then fail when it discovers that the contents are not complete. So make sure to remove the transcriptome-index folder for the first time AND after each error message when you want to try something new. I could get it (--transcriptome-index) work with --bowtie1 option but so far I had many other issues with bowtie2 (unfortunately) towards end of the analysis when tophat-report is called in. I hope this helps.

[neoyoung]

When I get the below error message during tophat running,
"Error: Could not find Bowtie 2 index files (...)"

I fixed it up with tophat command line like below,
# tophat -p 12 /home/NGS_work/bowtie2/indexes/hg18/hg18 seq_1.fa

My folder for bowtie indexes is like below
"indexes" folder > "hg18" folder > hg18.1.bt2, hg18.2.bt2, hg18.3.bt2, hg18.4.bt2, hg18.rev.1.bt2, hg18.rev.2.bt2 files

You have to specify the index title name such as "hg18" for the index path in the command line of Tophat.

If you have hg19 indexes files in the "Test" folder, you write command like below...
# tophat -p 12 /absolute path to "Test" folder/hg19 yourSeqfile.fa

[wanfahmi]

Hey Everybody,

The reason why the tophat couldn't find the bowtie indexes because you didn't specify the path in your working directory.

The easiest way you just make link to your working directory from the reference genome which already having the indexes sequence.

ln -s /path/to/your/genome/hg19/Annotation/Genes/genes.gtf .
ln -s /path/to/your/genome/hg19/Sequence/BowtieIndex/genome.*.

Then, when you run from your working directory it could find those indexes.

Just my thought, hope this help!

[Ajayi Oyeyemi]

Errors in Bowtie index files.

Hi everyone, I'm just new into RNA-seq analysis and this thread has been very helpful. However, I've been having difficulty in my alignment using tophat.
[ooa4@cbsum1c1b009 rnaseq]$ tophat -p12 /home/workdir/ooa4/rnaseq/ bosTau7 SRR594497.fastq SRR594499.fastq

[2013-02-07 14:09:57] Beginning TopHat run (v2.0.7)
-----------------------------------------------
[2013-02-07 14:09:57] Checking for Bowtie
Bowtie version: 2.0.6.0
[2013-02-07 14:09:57] Checking for Samtools
Samtools version: 0.1.18.0
[2013-02-07 14:09:57] Checking for Bowtie index files
Error: Could not find Bowtie 2 index files (/home/workdir/ooa4/rnaseq/.*.bt2)

My ls
[ooa4@cbsum1c1b009 rnaseq]$ ls
bosTau7.1.ebwt bosTau7.3.ebwt bosTau7.fa bosTau7.rev.1.ebwt bovine gtf files.gz SRR594497.sra SRR594499.fastq tophat_out
bosTau7.2.ebwt bosTau7.4.ebwt bosTau7.fa.gz bosTau7.rev.2.ebwt SRR594497.fastq SRR594497.sra.1 SRR594499.sra

Can someone please help me?

Yemi.

[Dario1984]

It's exactly what the error messages tells you. You don't have Bowtie 2 indexes. If the files end in ebwt, then they are Bowtie 1 indexes.

[Ajayi Oyeyemi]

It's exactly what the error messages tells you. You don't have Bowtie 2 indexes. If the files end in ebwt, then they are Bowtie 1 indexes.

Thanks. So what do you suggest I do? Should I go ahead and use the pre-built index files in bowtie website or I should build one? In anycase what are the indicators that suggests that it's bowtie2? Please forgive me for my Ignorance.

[Dario1984]

Error: Could not find Bowtie 2 index files (/home/workdir/ooa4/rnaseq/.*.bt2)

See the pattern in the error message. It ends with bt2. They don't have the cow index on their website, so you will have to make it.

[Ajayi Oyeyemi]

index and gtf conflict.

See the pattern in the error message. It ends with bt2. They don't have the cow index on their website, so you will have to make it.

Hi,
I downloaded the bovine genome from this site http://hgdownload.soe.ucsc.edu/golde...sTau7/bigZips/ and I used the bowtie2-build to construct my index files. However, my gtf file was also downloaded from this site http://genome.ucsc.edu/cgi-bin/hgTables ( I used the latest version BaylorBtau_4.6.1/bosTau7). I faced a lot of problems during alignment with tophat and someone mentioned that chromosome numbering differs( for genome is 1 and for the gtf file chr 1). I don't know how to fix this. Can someone point out where I can get a gtf file that is compatible the site I got my genome from?

Please I really need your help as I'm new to rna-seq data analysis.

Thanks.

[Dario1984]

That is not true. I downloaded bosTau7.fa and had a look at the beginning of the file with R.

> readLines("F:\\bosTau7.fa", n=10)
 [1] ">chr1"                                             
 [2] "taccccactcacacttatggatagatcaactaaacagaaaattaacaagg"
 [3] "aaaaaaaaaAAAAAAAAAACATGTATCTATAAAGCTCACTAAAGCAAAGC"
 [4] "ACAGTAAAATGAGGTATGGCAATAAAAGGCGTTAAATTTATCaaaaaaaa"
 [5] "aaaaaaaaagtgctgaaaaattaaaaaaaaaaaaaagaaaaaaaTATAGA"
 [6] "GATAAAATTAAATTTTTGTATTTATTCTTGCCGTTGAAAATTATGGGCAA"
 [7] "CTTTTCATTTTTTCAAATTTAATATTGTGTTACTCAAAAATACCCTAAAG"
 [8] "TTGATCTCTGTTTAAATCTAGAACACTTTTTGTTAAGTTTATGTCGATAT"
 [9] "GTCTTAGCTCTTTTTTTTAATTAGACATGATATTTTCTTTCATCACATTT"
[10] "TCAATATGTAGGAGAGCTAGTGATATTTGTGTAATAATTTTGTACTCGGC"

Note the first line. The chromosome naming style is the same as in the GTF file. Your problem is something else. You must show the exact error message you receive to get relevant help.

[jsimba]

Bowtie error on tophat

Hi everyone,

Im new in RNA seq data analysis Im just learning how to install tophat, bowtie and so on, doing the troubleshooting of tophat recommended by their website I obtain this:

2013-02-18 16:10:51] Checking for Bowtie
Bowtie 2 not found, checking for older version..
Error: Bowtie not found on this system.

the line that I used is this:

./tophat -r 20 test_ref reads_1.fq reads_2.fq

Prevously I Installed bowtie2 and guessed only to change bowtie files to tophat directory was enough but doesnt work so what should I do??

Thanks

[Dario1984]

You need to have the path to the bowtie2 executable file in your PATH environment variable.

[Ajayi Oyeyemi]

That is not true. I downloaded bosTau7.fa and had a look at the beginning of the file with R.

> readLines("F:\\bosTau7.fa", n=10)
 [1] ">chr1"                                             
 [2] "taccccactcacacttatggatagatcaactaaacagaaaattaacaagg"
 [3] "aaaaaaaaaAAAAAAAAAACATGTATCTATAAAGCTCACTAAAGCAAAGC"
 [4] "ACAGTAAAATGAGGTATGGCAATAAAAGGCGTTAAATTTATCaaaaaaaa"
 [5] "aaaaaaaaagtgctgaaaaattaaaaaaaaaaaaaagaaaaaaaTATAGA"
 [6] "GATAAAATTAAATTTTTGTATTTATTCTTGCCGTTGAAAATTATGGGCAA"
 [7] "CTTTTCATTTTTTCAAATTTAATATTGTGTTACTCAAAAATACCCTAAAG"
 [8] "TTGATCTCTGTTTAAATCTAGAACACTTTTTGTTAAGTTTATGTCGATAT"
 [9] "GTCTTAGCTCTTTTTTTTAATTAGACATGATATTTTCTTTCATCACATTT"
[10] "TCAATATGTAGGAGAGCTAGTGATATTTGTGTAATAATTTTGTACTCGGC"

Note the first line. The chromosome naming style is the same as in the GTF file. Your problem is something else. You must show the exact error message you receive to get relevant help.

hanks Dario, let me be much more clearer. I downloaded the cow genome from the igenome in cufflinks website and I unpacked the tar.gz file. I created a link using the ln -s function to the gtf file and the genome. See below the result I got.

[ooa4@cbsum1c1b009 ooa4]$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome.*.
[ooa4@cbsum1c1b009 ooa4]$ ln -s ./Bos_taurus/NCBI/Btau_4.6.1/Annotation/Genes/genes.gtf
[ooa4@cbsum1c1b009 ooa4]$ ls -al
total 43380296
drwxrwxr-x 9 ooa4 ooa4 4096 Feb 18 16:05 .
drwxrwxrwx. 3 root root 4096 Feb 7 12:46 ..
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 18 15:57 Bos_taurus
-rw-rw-r-- 1 ooa4 ooa4 27915273767 Feb 13 15:47 Bos_taurus_NCBI_Btau_4.6.1.tar.gz
-rw-rw-r-- 1 ooa4 ooa4 32225697 Feb 18 15:46 bovineee
lrwxrwxrwx 1 ooa4 ooa4 55 Feb 18 16:05 genes.gtf -> ./Bos_taurus/NCBI/Btau_4.6.1/Annotation/Genes/genes.gtf
lrwxrwxrwx 1 ooa4 ooa4 60 Feb 18 16:04 genome.*. -> ./Bos_taurus/NCBI/Btau_4.6.1/Sequence/Bowtie2Index/genome.*.
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 12 16:31 index
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 08:44 output1
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 08:45 output1B
-rwxrwxr-x 1 ooa4 ooa4 5790 Mar 20 2012 README.txt
-rw-rw-r-- 1 ooa4 ooa4 6683898300 Feb 8 15:00 SRR594497.fastq
-rw-rw-r-- 1 ooa4 ooa4 995599407 Feb 8 11:48 SRR594497.sra
-rw-rw-r-- 1 ooa4 ooa4 7338744848 Feb 8 15:07 SRR594499.fastq
-rw-rw-r-- 1 ooa4 ooa4 1436256918 Feb 8 11:47 SRR594499.sra
drwxrwxr-x 4 ooa4 ooa4 4096 Feb 16 10:09 top_gtf
drwxr-xr-x 4 root root 4096 Feb 13 09:13 tophat_output2
drwxrwxr-x 3 ooa4 ooa4 4096 Feb 16 10:02 unique_output
-rw-rw-r-- 1 ooa4 ooa4 19337728 Feb 13 15:47 wget-log
[ooa4@cbsum1c1b009 ooa4]$ tophat2 -p 8 -G genes.gtf -o SRR594497_tophat genome SRR594497.fastq

[2013-02-18 16:06:49] Beginning TopHat run (v2.0.7)
-----------------------------------------------
[2013-02-18 16:06:49] Checking for Bowtie
Bowtie version: 2.0.6.0
[2013-02-18 16:06:49] Checking for Samtools
Samtools version: 0.1.18.0
[2013-02-18 16:06:49] Checking for Bowtie index files
Error: Could not find Bowtie 2 index files (genome.*.bt2)

I'm using the trapnell protocol and I'm following it to the letter.
Any advice?