SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
DEXSeq error in estimateDispersions: match.arg(start.method, c("log(y)", "mean")) fpadilla Bioinformatics 14 07-03-2013 02:11 PM
GATK "MAPQ should be 0 for unmapped read" complaint for mapped read efoss Bioinformatics 12 10-18-2012 01:19 AM
Relatively large proportion of "LOWDATA", "FAIL" of FPKM_status running cufflink ruben6um Bioinformatics 3 10-12-2011 12:39 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM

Reply
 
Thread Tools
Old 07-17-2013, 11:16 PM   #1
PatB
Junior Member
 
Location: Spain

Join Date: Feb 2013
Posts: 3
Default miRDeep-p "problem in read format"

Hi!!

I am using miRDeep-p since 1 week and everything was OK until I execute the last script. In the manual this script is named miRDeep.pl, but in the zipped file that you can download its name is miRDP.pl. Is this normal? Am I using an incorrect file?

Anyway, if I use this miRDP.pl script it returns me multiple error “problem in read format". I will paste here a little part of my files and my command line in case of someone can help me.

Thank you in advance!

Command line: perl miRDP.pl LC30_miRDeep_signatures LC30_miRDeep_structures > LC30_miRDeep_prediction

LC30_miRDeep_signatures:
ILLUMINA-8C6145:810:MP-SR4:1:2:3109:6128 23 1..23 chr01_0 250 23..45 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:92:7614:17418 25 1..25 chr01_1000 250 204..228 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:64:10868:11129 18 1..18 chr01_1001 250 23..40 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:64:10868:11129 18 1..18 chr01_1002 250 211..228 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:70:10235:17534 22 1..22 chr01_100 250 207..228 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:32:8332:13923 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:64:13668:14678 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:2:74:14818:9808 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:32:8332:13923 24 1..24 chr01_1004 250 205..228 1e-04 1.00 42.1 Plus / Plus
ILLUMINA-8C6145:810:MP-SR4:1:64:13668:14678 24 1..24 chr01_1004 250 205..228 1e-04 1.00 42.1 Plus / Plus

LC30_miRDeep_structures:
>chr01_0 strand:+ excise_beg:22126 excise_end:22375
CAAACGACGACGAGGGAGGUGGCAGGACGCGUCCCACGAGGUGGCUUGUCCAUAGAAGGUGGCAGUUGGCAAUGAAAAAACAAAAAACAGUGGAAACGCAGUCAGCAAUGACAUGGUCCCGAUGGAGAUAGAAACAACAACAAUUAGCUCUGGUGGUGAACACGACCAGGUGAGUGUGUCAAAAUGCGUUUCCGGACAAGGGGUUAUGGUUUCCUUAAACGCGCUGGAGAAACGAAAGACGGAAAAAAGA
....(.((..((.((((.(((......))).)))).))..)).)(((((((........((.(....).))....................(((((((((((((....))))....(((....)))..........(((.((....((.(((((.((....)).)))))))...))))).....))))))))))))))))..(((.(.(((((((..........)).))))).)..))).......... (-64.70)
>chr01_1 strand:+ excise_beg:21943 excise_end:22192
UCUGUUGGUGAACACGAUCGGAUGAGUGCAUGAAAAUGUGUUCCUGGAUAAAAGGGUUUCAGUUUCUUGAACGCGUAGGAGGAAUGAAAGACGGAGAAAAAAUGACUAACACUGUUCAUCGUCUUCGCUAGCCGAAACGAGAAAUAUAAUUGGAGGAAAGAUCGGCGUCGGUGCUUCGGCGACCAAACGACGACGAGGGAGGUGGCAGGACGCGUCCCACGAGGUGGCUUGUCCAUAGAAGGUGGCAGUU
.((((.......(((..(((((((((.((((....))))..((((.......))))(((((((((((((..((..((((((((.(((..(((((.................)))))..)))))))).)))..))...)))))))).....)))))........((((((((....)))))).))...(.((..((.((((.(((......))).)))).))..)).))))))))...))..))))))).. (-66.40)
>chr01_2 strand:+ excise_beg:56028 excise_end:56277
GAGCUUAAGAUUCUGAGAAGCAGUUGAUAGGUAGCCAACUUCUAAAAAUCUGAAAAAGCUGGGUUUCUCAGCUUCUGACUUCUAGUUCAUUUUCUGGACUCUAUAACUACAGCUUCUCAGAAUCUGGACCAAAAGCUGGAUUGUUUAGAUGAGCUUCUGAUUCUAGAAAAAACUGCAGCAGCAAGCUCCCCAAACAGACCCUUAAGAGUCUCGUAGGAAAAAAAAUAAUAUUGGUUGGAUACAUUUGAUU
.......(((((((((((((((((((.((((........(((.........))).((((((((...))))))))......(((((........))))).)))))))))...)))))))))))))).((((((((((......))))....(((((((((.((.(((......))).))))).)))))).((..((((((........)))).)).)).............)))))).............. (-59.10)
__________________
Patrícia Baldrich González
Departament of Molecular Genetics
Center for Research in Agricultural Genomics(CRAG) Parc de Recerca UAB
Edifici CRAG, Campus UAB Bellaterra (Cerdanyola del Vallés)
08193 BARCELONA SPAIN
0034 93 563 6600 Ext. 3124
Email: patricia.baldrich@cragenomica.es
PatB is offline   Reply With Quote
Old 09-13-2013, 11:58 AM   #2
Latifa77
Junior Member
 
Location: Lima

Join Date: Sep 2013
Posts: 6
Default

Hi, do you keep using mirDeep-P? Could you solve your problem and have good results?
Latifa77 is offline   Reply With Quote
Old 09-16-2013, 08:13 AM   #3
PatB
Junior Member
 
Location: Spain

Join Date: Feb 2013
Posts: 3
Default

Hi!

Yes finally I solve the problem and miRDEEP -p is working properly. It was a mistake in the ID name of the reads. Thanks!
__________________
Patrícia Baldrich González
Departament of Molecular Genetics
Center for Research in Agricultural Genomics(CRAG) Parc de Recerca UAB
Edifici CRAG, Campus UAB Bellaterra (Cerdanyola del Vallés)
08193 BARCELONA SPAIN
0034 93 563 6600 Ext. 3124
Email: patricia.baldrich@cragenomica.es
PatB is offline   Reply With Quote
Old 09-29-2013, 09:20 PM   #4
Latifa77
Junior Member
 
Location: Lima

Join Date: Sep 2013
Posts: 6
Default

I have a question, when you run the script rm_redundant_meet_plant.pl did you see lines with this comment in the terminal??:

Use of uninitialized value in subtraction (-) at ./rm_redundant_meet_plant.pl line 147, <FILE> line 792223

I am trying to uses mirdeep-p but I think my results are not good.
Latifa77 is offline   Reply With Quote
Reply

Tags
mirdeep-p, mirnaseq, problem

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:43 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO