SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to align reads to multiple index in bowtie2 ssharma Bioinformatics 3 07-16-2013 03:13 AM
Using bam files to align to custom sequences johnibozo RNA Sequencing 0 12-22-2012 03:54 AM
how to align concatenated and sheared sequences? Lilach Bioinformatics 2 11-04-2012 07:17 AM
align short query against 300M Illumina reads hohllp Bioinformatics 5 11-21-2011 12:40 PM
Query :: Unable to create index file in soapaligner sujata Bioinformatics 0 02-06-2011 08:25 PM

Reply
 
Thread Tools
Old 10-02-2013, 07:04 PM   #1
quokka
Member
 
Location: oz

Join Date: Apr 2010
Posts: 12
Exclamation Bowtie2 is unable to align query sequences that contain an intervening stretch of N's

If I have a reference sequence:
>reference
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCAAGATTCGCGTGACCCCCACATCCTGGTTCTTCACGAGCAAAGTGTCCTTGCAAATA

and two query sequences (in a multifasta file):
>query1
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
>query2
GCAAGATTCGCGTGACCCCCACATCCTGGTTCTTCACGAGCAAAGTGTCCTTGCAAATA

bowtie2 will correctly map the two query sequences onto the reference.

However, if I change the query to exactly match the reference:
>query
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCAAGATTCGCGTGACCCCCACATCCTGGTTCTTCACGAGCAAAGTGTCCTTGCAAATA

the query does not map (at all) to the reference.

The command line parameters are:
bowtie2 --sensitive-local -x reference.fa -f -U query.fa -S output.sam

Can anyone explain why this occurs?
quokka is offline   Reply With Quote
Old 10-03-2013, 03:10 AM   #2
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

Yes, the --n-ceil option defaults to L,0,0.15 which, for your 177 base sequence, is 26 while your read has 59 Ns. You'll probably also have to change -np, which defaults to 1 and could result in the alignment being being below --min-score (I could calculate that, but I'll leave that to you).
dpryan is offline   Reply With Quote
Old 10-03-2013, 12:18 PM   #3
quokka
Member
 
Location: oz

Join Date: Apr 2010
Posts: 12
Default

Ah...thanks so much Devon. Thank god someone has read the manual!...
quokka is offline   Reply With Quote
Reply

Tags
bowtie 2, bowtie2, error, n's, problem

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:23 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO