SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
DEXseq - very low numbers of counts kajot RNA Sequencing 6 08-03-2018 11:04 PM
Transcriptome assembly: Low GC, short contigs, low read alignment jmah Bioinformatics 0 03-15-2017 04:47 PM
Low alignment rates with bowtie2 and bwa for a bacterial genome seatales Bioinformatics 8 03-11-2016 04:36 AM
Getting very low numbers of annotated reads from STAR/mm10 analog900 Bioinformatics 8 01-12-2016 11:02 AM
Very low read numbers from haloplex libraries henry.wood Illumina/Solexa 7 10-16-2015 01:15 AM

Reply
 
Thread Tools
Old 02-19-2018, 11:52 AM   #1
scottr08
Junior Member
 
Location: Baton Rouge, LA

Join Date: Feb 2017
Posts: 3
Default Really Low Bowtie2 Alignment Numbers From Demultiplex in STACKS

In STACKS, I ran process_radtags and get close to 20 million reads. They are paired-end 150bp reads.

/home/srile14/stacks-1.48/process_radtags -p /work/srile14/FastqFiles_MS2_044_Kelly_OysterRADseq/ \
--paired \
-i gzfastq \
-b /work/srile14/demulti --inline_inline \
-o /work/srile14/test-out \
-c -q -r -t 140 -w 0.15 -s 10 \
--renz_1 xbaI \
--renz_2 ecoRI \
--adapter_mm 2 \
--adapter_1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
--adapter_2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \


20272558 total sequences
142938 reads contained adapter sequence (0.7%)
356902 ambiguous barcode drops (1.8%)
0 low quality read drops (0.0%)
19436 ambiguous RAD-Tag drops (0.1%)
19753282 retained reads (97.4%)



When I go to align those reads to the genome I created with bowtie2-build, I get only 14,641 reads.

bowtie2 -q -x /work/srile14/virginica_genome/virginica_genome \
-1 Sample_96.1.fq,Sample_95.1.fq,Sample_94.1.fq,....Sample_1.1.fq
-2 Sample_96.2.fq,Sample_95.2.fq,Sample_94.2.fq,....Sample_1.2.fq
-S /work/srile14/stdout



14641 reads; of these:
14641 (100.00%) were paired; of these:
4171 (28.49%) aligned concordantly 0 times
5341 (36.48%) aligned concordantly exactly 1 time
5129 (35.03%) aligned concordantly >1 times
----
4171 pairs aligned concordantly 0 times; of these:
88 (2.11%) aligned discordantly 1 time
----
4083 pairs aligned 0 times concordantly or discordantly; of these:
8166 mates make up the pairs; of these:
5678 (69.53%) aligned 0 times
1199 (14.68%) aligned exactly 1 time
1289 (15.78%) aligned >1 times
80.61% overall alignment rate


The overall alignment rate is high, but the total number of reads mapped seems extremely low (14,651 out of 20 million). Is there something I am missing? Or is this common for longer reads?

Thanks in advance,

Scott
scottr08 is offline   Reply With Quote
Old 02-19-2018, 02:25 PM   #2
mastal
Senior Member
 
Location: uk

Join Date: Mar 2009
Posts: 667
Default

A very low alignment rate could be a sign that the reads are not from the species you expected.
mastal is offline   Reply With Quote
Old 02-19-2018, 07:34 PM   #3
SNPsaurus
Registered Vendor
 
Location: Eugene, OR

Join Date: May 2013
Posts: 501
Default

Can you make a de novo reference in Stacks and blast the loci sequences to see what they are? As mastal says, it could be that your samples are heavily contaminated with some other species (like bacteria). Or just grab 10 reads from a few samples and blast them. It is always good to go to the starting material and check it out directly.

If your samples are not the exact species as the reference, then it may be that you need to allow more mismatches during the alignment.
__________________
Providing nextRAD genotyping and PacBio sequencing services. http://snpsaurus.com
SNPsaurus is offline   Reply With Quote
Reply

Tags
bowtie 2, bowtie alignment illumina, radseq, stacks

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:45 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO