SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
how bwa and bowtie handle repeats? henry Bioinformatics 7 04-30-2014 03:52 AM
Help: how to handle .bam file lewewoo Bioinformatics 3 11-07-2011 04:14 PM
how to use SOAPdenovo to handle the Solid data. ryuky SOLiD 1 03-23-2011 12:45 AM
how does bowtie handle n's in reads? ref sequence? nashp Bioinformatics 0 01-10-2011 04:09 PM
Software to handle BACs jie Bioinformatics 0 09-15-2009 12:29 PM

Reply
 
Thread Tools
Old 03-19-2011, 05:11 AM   #1
ips
Member
 
Location: China Xian

Join Date: Jan 2011
Posts: 11
Default How to handle this dataset?

Hi all,
I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:

chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
This history column did not show "display at UCSC main "
How can I get visialized in UCSC genome browser?
ips is offline   Reply With Quote
Old 03-19-2011, 05:45 AM   #2
Simon Anders
Senior Member
 
Location: Heidelberg, Germany

Join Date: Feb 2010
Posts: 994
Default

You haven't even told us what application you are talking about.
Simon Anders is offline   Reply With Quote
Old 03-19-2011, 05:07 PM   #3
ips
Member
 
Location: China Xian

Join Date: Jan 2011
Posts: 11
Default

I want to do Chip-seq analysis for this data.
ips is offline   Reply With Quote
Old 03-20-2011, 12:10 PM   #4
RDW
Member
 
Location: London

Join Date: Oct 2008
Posts: 63
Default

Yes, but what software are you trying to use? From the option names, my guess would be Galaxy. Are you able to display other Galaxy data on the UCSC browser, or is the problem just with this file?
RDW is offline   Reply With Quote
Old 03-21-2011, 12:23 AM   #5
ips
Member
 
Location: China Xian

Join Date: Jan 2011
Posts: 11
Default

I can display other Galaxy data on the UCSC browser.
ips is offline   Reply With Quote
Old 03-21-2011, 12:41 AM   #6
ips
Member
 
Location: China Xian

Join Date: Jan 2011
Posts: 11
Default

By the way, the dataset available in http://www.ncbi.nlm.nih.gov/geo/quer...i?acc=GSE12241

Last edited by ips; 03-21-2011 at 01:39 AM.
ips is offline   Reply With Quote
Old 03-21-2011, 04:29 PM   #7
nexgengirl
Member
 
Location: Maryland

Join Date: Apr 2010
Posts: 31
Default

Hi,

To view in the UCSC it should be in the bed format. See this page:
http://genome.ucsc.edu/FAQ/FAQformat.html#format1

For you data I think if you follow these steps you should be able to view it in the browser. I just tried it using the lines you provided and it worked so hope this helps.

1. Make sure you have assigned a database to your dataset. (for example hg18 or hg19)
2. Since the data is currently separated by spaces and you want it in tab use this tool:
a. Under Text manipulation click Convert delimiters to TAB. (Convert all: Whitespaces)
3. Change the datatype of your data to bed
4. When I did this and clicked display at UCSC main it gave an error because the strand is in the wrong column.
a. For this I used the Cut tool under Text Manipulation and cut columns (in this order) c1,c2,c3,c7,c5,c4 which correlate with chromosome, start, end, name, score, strand.
b. I'm not sure which column is your score column so you may do this differently
5. After these steps I clicked UCSC main view and it displayed

I really hope this helps!
nexgengirl is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:55 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO