SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
format indelse file MAQ katarina Bioinformatics 1 03-25-2010 03:18 AM
MAQ output format m_elena_bioinfo Bioinformatics 0 12-09-2009 02:35 AM
Maq output to SAM format marcowanger Bioinformatics 8 08-09-2009 04:12 PM
MAQ output format seq_GA Bioinformatics 0 05-21-2009 12:43 AM
Maq output: assemble.log file contains what? soniat Bioinformatics 0 12-15-2008 07:25 AM

Reply
 
Thread Tools
Old 03-17-2010, 01:58 AM   #1
zcrself
Junior Member
 
Location: shanghai

Join Date: Sep 2009
Posts: 4
Default the format of output file of Maq

Code:
HWI-EAS-249_42:1:1:10:282#0/2	chromosome01	8649295	-	0	0	0	0	0	11	20	0	12	76	aattccaaggagcctgcttgacctgtgtttcgtctgaacttcaaccctcctcgatgctgcttctctaagctgaacT	########################################!############################;4864:A
HWI-EAS-249_42:1:1:10:1227#0/2	chromosome01	8757671	-	0	0	19	19	19	10	25	0	0	76	gagtcgttaaaaaaaatctatttcttagggttatttcttgggggacggaagattatactccccccgtcctataatA	#########################################9;9(;779479(949(9;98;;8;78679696;9B
HWI-EAS-249_42:1:1:12:1701#0/2	chromosome01	11998357	+	0	0	19	19	19	15	36	0	0	76	CaacGGattggctggtgacaccgatatctgactttatggctcgcgcctgtggtgggacccagcgtcgtgggcgggg	B55,??335###################################################################
HWI-EAS-249_42:1:1:11:1076#0/2	chromosome01	12313108	-	0	0	6	6	6	6	10	0	0	76	aaatcagcttcccaagatgtcgtacccccagaatggtcataatttacggatgttctcatttcattaacaaaaCCtT	##########################################!#############################@?0?
HWI-EAS-249_42:1:1:11:637#0/2	chromosome01	13502430	+	0	0	19	19	19	6	12	0	0	76	cggatttaattggatagatatatctatacggttaaacttgagtgcaggacctccgactggttcacctatacgcact	############################################################################
this file was produced by Maq-0.7.1
what means of every columns?
zcrself is offline   Reply With Quote
Old 03-17-2010, 11:15 PM   #2
zcrself
Junior Member
 
Location: shanghai

Join Date: Sep 2009
Posts: 4
Default the format of map which is produced by Maq

read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality
zcrself is offline   Reply With Quote
Old 03-18-2010, 12:09 AM   #3
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by zcrself View Post
read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality
See:
http://maq.sourceforge.net/maq-manpage.shtml
http://maq.sourceforge.net/maqmap_format.shtml
nilshomer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO