SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Extract sequence from multi fasta file with PERL andreitudor Bioinformatics 27 07-07-2019 08:45 AM
Make Multi-fasta with annotations detq182 Bioinformatics 4 04-15-2012 06:50 AM
samtools flagstats bug or it does not support multi-reads? xinwu Bioinformatics 0 12-22-2010 10:33 PM
RNA-Seq: ABMapper: a suffix array-based tool for multi-location searching and splice- Newsbot! Literature Watch 0 12-21-2010 03:00 AM
Gene prediction programs that work with multi-fasta files Hobbe Bioinformatics 0 11-16-2010 02:31 AM

Reply
 
Thread Tools
Old 05-07-2012, 04:40 PM   #1
ikarus97
Junior Member
 
Location: lawrence, ks

Join Date: Apr 2010
Posts: 6
Default Does Picard tool support multi-fasta file?

Hi,

I'm trying to check alignment accuracy of bam files generated by tophat using Picard tools.
But the resulting mismatch rates ('PF_MISMATCH_RATE') were unreasonably high.
When trying to figure out why, I found some strange things.

Here is the entries in the sample bam file:
Code:
@HD     VN:1.0  SO:coordinate
@SQ     SN:chr1 LN:249250621
@PG     ID:TopHat       VN:1.4.0
1925_202_1426   0       chr1    1102502 255     23M     *       0       0       GCCATCTTACTGGGCAGCATTGG ___abbb_[NRb``[[`Y[_^&& NM:i:0  NH:i:1
49_971_1359     0       chr1    1102503 255     23M     *       0       0       CCATCTTACTGGGCAGCATTGGA QQIFIQ?@NW`VP@E[EGUVVEE NM:i:0  NH:i:1
76_239_469      0       chr1    1102503 255     22M     *       0       0       CCATCTTACTGGGCAGCATTGG  WWVTUXRS[^^`[CGL<N8;KK  NM:i:0  NH:i:1
All 3 reads were single-ended, and originated from chr1.fa (and aligned to chr1 perfectly).

First I tried 'CollectAlignmentSummaryMetrics' module just using reference sequence for chr1, and got mismatch rate of 0.
Code:
java -jar ~/picard-tools-1.67/CollectAlignmentSummaryMetrics.jar INPUT=hh.sam R=chr1.fa OUTPUT=tmp
But when I tried the same command with multi-fasta file containing every chromosomes, I got the mismatch rate of 0.77!

Is there anybody who can explain me what is wrong?
My first hunch is that this tool might not support multi-fasta format as reference. But then, how can I get the mismatch rate of a bam file?
ikarus97 is offline   Reply With Quote
Old 05-07-2012, 05:05 PM   #2
ikarus97
Junior Member
 
Location: lawrence, ks

Join Date: Apr 2010
Posts: 6
Default

I've got my answer: the reference sequences in fasta file should be in the same order as in the bam header.
ikarus97 is offline   Reply With Quote
Old 05-13-2013, 05:59 PM   #3
jh313
Junior Member
 
Location: Wisconsin

Join Date: Apr 2013
Posts: 2
Default

Hey ikarus97, I was getting a similar issue. How did you fix the order of the reference sequences in the fasta file?
jh313 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO