about illumina reads quality score

[gridbird]

I got sequencing reads like this:

@HWI-ST644:6806CMACXX:3:1101:2217:2245 1:N:0:CGATGT
TATTATGGGCGCACTGAAGGTGTAGAAACTGCCGTCCTCCGTGATGACGGACATATTCGTTTCGTTGGGAAAATTCCTTACGGTAGCCTTCACACGGATG
+
CCCFFFFFHFHHHJJJIJJJFGHGHIIJJJJJJJHIIJJJJIJJFIJJJIIJHHHHHFFFFFCDDEDDDDDDDDDDDDDDDDDCBDDDDDDDCCDDDDDB

but I am wondering which version of Illumina GA pipeline used. I just want to get the quality score of each base, but I don't know how to caculate it. I just found the information from wiki:

NCBI/Sanger or Illumina 1.8 and later. Using a Phred scale encoded using ASCII 33 to 93.
Illumina Pipeline 1.2 and earlier. Using a Solexa/Illumina scale (-5 to 40) using ASCII 59 to 104. T
Illumina Pipeline 1.3 and 1.4. Using a Phred scale using ASCII 64 to 104.
Illumina Pipeline 1.5 to 1.7. Using a Phred scale using ASCII 64 to 104.

[chadn737]

This looks like v1.8 so the quality scores should be ASCII 33

[HESmith]

The scores indicate v1.8. Your highest score is 'J', which is ASCII 74. With offset +33, that's 41, which is currently Illumina's top quality score.

Another way to check is to look for reads with Illumina's low quality flag (2); # for v1.8, B for earlier versions.

[gridbird]

Thanks for help!!

[dongzw]

Thank you all for sharing the information!