
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
How to mask and not remove "adapter" sequence? GeGnome Bioinformatics 3 09-09-2015 06:41 AM
can't remove subset of adapter sequences jasbhead Bioinformatics 5 02-18-2014 02:10 PM
adapter remove yueli Bioinformatics 0 11-15-2013 05:57 AM
Remove the adapter sequence by fastx_clipper in fastq file Jiafen Bioinformatics 14 08-08-2013 02:16 AM
Remove adapter sequence vini SOLiD 1 04-13-2011 10:28 AM

Thread Tools
Old 04-28-2015, 04:13 AM   #1
Junior Member
Location: Bangkok, Thailand

Join Date: Apr 2015
Posts: 9
Default Please help my BBMap cannot remove Illumina adapter

Dear great helpers,

I'm an RNAseq starter and trying to find a good tool for fastq file preprocessing. I currently use BBmap to trim Illumina addapter using the command: -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1

The f1.fq and f2.fq are from Illumina 1.9. When I check the output clean1.fq and clean2.fq files using FastQC. There is still evidence of adapter contamination.

GATCGGAAGAGCACACGTC 25845 0.18387555456141572 Illumina Multiplexing Adapter 1 (100% over 19bp)

I think this could be solved by adjusting parameters, but I'm too naive to do it. Would you please suggest me how to solve the problem?

Thank you very much in advance,
TofuKaj is offline   Reply With Quote
Old 04-28-2015, 04:47 AM   #2
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,600

It is not removing the adapters since you are missing a key option on your command line for bbduk .. the location of the file containing the sequence of the adapters.

Your command should be
$ -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1 ref=/path_to/bbmap-34.xx/bbmap/resources/truseq.fa.gz
Replace the truseq file with nextera if you are using those adapters.

Last edited by GenoMax; 04-28-2015 at 05:31 AM.
GenoMax is offline   Reply With Quote
Old 04-28-2015, 05:16 AM   #3
Junior Member
Location: Bangkok, Thailand

Join Date: Apr 2015
Posts: 9

Originally Posted by GenoMax View Post
It is not removing the adapters since you are missing a key option on your command line for bbduk .. the location of the file containing the sequence of the adapters.

Your command should be
$ -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1 ref=/path_to/bbmap-34.xx/bbmap/resources/truseq.fa.gz
Replace the truseq file with nextera if you are using those adapters.
Thank you very much for your quick help
I'm so sorry
for my ambiguous post. In fact, I have added the path to my code but skipping it in the post. Please describe me a little bit more why you suggest the use of truseq.fa.gz instead of truseq_rna.fa.gz
Thank you very much in advance
TofuKaj is offline   Reply With Quote
Old 04-28-2015, 05:28 AM   #4
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,600

Example you posted above looks like "TruSeq_Adapter". TruSeq_RNA adapters are different (TGGAATTCTCGGGTGCCAAGGAA). You can take a look at the adapter sequences in the "bbmap-34.xx/bbmap/resources" directory.

My apologies. I see that you have "ref=" in your original command line.

Last edited by GenoMax; 04-28-2015 at 05:31 AM.
GenoMax is offline   Reply With Quote
Old 04-28-2015, 09:53 AM   #5
Brian Bushnell
Super Moderator
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,696

If you're not sure which adapters are used, you can do "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible). But as GenoMax said, that looks like a normal TruSeq adapter, not TruSeq RNA.

Also, as these are paired reads, I suggest you add the "tbo" and "tpe" flags to trim by overlap also, which will get rid of more adapter sequence.

Last edited by Brian Bushnell; 04-28-2015 at 09:59 AM.
Brian Bushnell is offline   Reply With Quote

adapter trimming, bbmap

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 05:08 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO