SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to use Picard's MarkDuplicates cliff Bioinformatics 12 01-26-2015 10:56 PM
picard error seq_GA Bioinformatics 2 07-15-2014 04:50 AM
Picard bair Bioinformatics 2 07-15-2014 04:45 AM
Picard and GATK poisson200 Bioinformatics 6 08-15-2012 07:04 AM
Picard: HsMetrics Seq84 Bioinformatics 0 04-18-2011 02:24 AM

Reply
 
Thread Tools
Old 12-01-2011, 06:40 AM   #1
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default About Picard

When I run the software, it returns an error.
you can see it in the attachment, please give me some suggestion.
thank you very much.
Attached Images
File Type: jpg 222.jpg (68.9 KB, 35 views)
Jin Pan is offline   Reply With Quote
Old 12-01-2011, 09:56 AM   #2
spapillon
Junior Member
 
Location: Montreal, Canada

Join Date: Nov 2011
Posts: 4
Default

As the error states, "Sequence must start with @: >@ ..." Meaning that Picard is trying to read the sequence and is failing. It calls the method FastqToSam but the file you gave it is in fasta format. You need to convert it beforehand (remove the '>' at the beginning of lines)
spapillon is offline   Reply With Quote
Old 12-01-2011, 04:56 PM   #3
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default

I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<
Jin Pan is offline   Reply With Quote
Old 12-01-2011, 05:03 PM   #4
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default

I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<
Jin Pan is offline   Reply With Quote
Old 12-01-2011, 05:04 PM   #5
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default

I opened and detected my data file, But i didn't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<
Jin Pan is offline   Reply With Quote
Old 12-01-2011, 05:21 PM   #6
skycreative
Member
 
Location: GuangXi China

Join Date: Jan 2010
Posts: 27
Default

would you try plat text file , not the gz file?
skycreative is offline   Reply With Quote
Old 12-01-2011, 05:27 PM   #7
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default

It's OK. Thanks a lot.
Jin Pan is offline   Reply With Quote
Old 12-01-2011, 06:01 PM   #8
Jin Pan
Junior Member
 
Location: China

Join Date: Dec 2011
Posts: 7
Default

If I run Estimatelibrarycomplexity.jar, it seems that the data format is wrong again.

ERROR: Error parsing SAM header. Unrecognized header record type. Line: @HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
Jin Pan is offline   Reply With Quote
Old 07-15-2014, 04:55 AM   #9
Lv Ray
Member
 
Location: GZ,China

Join Date: Jun 2014
Posts: 42
Default

how do you solved your hard problem?
Lv Ray is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:50 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO