SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics
Similar Threads
Thread Thread Starter Forum Replies Last Post
A question about BWA index louis7781x Bioinformatics 9 04-02-2012 02:23 AM
breakdancer output question csoong Bioinformatics 6 12-23-2010 02:46 AM
question about bwa jlfmssm Bioinformatics 1 06-26-2010 02:00 PM
Question about BWA options corthay Bioinformatics 0 04-21-2010 01:04 AM
BWA question jyli Bioinformatics 0 03-16-2010 06:13 AM

Reply
 
Thread Tools
Old 04-14-2011, 01:08 AM   #1
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default Question on BWA output

Hi all,

once again I have to ask for your help, since I couldn't find any thread on the board that is reflecting my problem.
First of all: I use artificially created single end reads in Illumina FASTQ format that look like the following (the quality values are not as yet of any concern, that is why it's h):

Quote:
@Identifier1:1:1:1:1#NNNNNN/1
ACAATGTTTCTCATGCTCCAGTGAT
+Identifier1:1:1:1:1#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhh
@Identifier2:1:2:1:1#NNNNNN/1
TTTCCTCATCTACAACAGTGATTGG
+Identifier2:1:2:1:1#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhh
To get used to BWA (I used bowtie before and that works fine with the data), I'm aligning them against a small part of the genome (the one I used to create them is included) which consists of several FASTA entries of exons, so basically:

Quote:
>RefIdentifier1
ACAATGTTTTTGATCTCTTTAACCTCATCTACCTCAGGCAACAATGTTTT
TGATCTCTTTAACCTCATCTACCTCAGGCAGTGCTCATGGTGATTTGTG
CTCATGGTGATTT
>RefIdentifier2
CATCTACCTCAGGCAACCTCATGGTATTTGTGCTCATGGTGATTCCCTA
TCTACTTTTGAACAATGTTTTTGATCTCTTTAACCTTCTCTTTAACCTCCT
CAGGCAGTGGATGATGACTGACTGACTGTTTGATCGTGACTGATCGTG
ATCTTTTTTACGGGACATTAAAAGGCGGGCCCTAAACTGAC
So far I've tried
Quote:
./bwa aln indexfile readfile.fastq > BWAout.sai
w/ and w/o the -I flag set, and after that:
Quote:
./bwa samse indexfile BWAout.sai readfile.fastq > BWAout.sam
It produces a SAM file that looks like this (independent of the -I flag):
Quote:
@SQ SN:RefIdentifier1 LN:124
@SQ SN:RefIdentifier2 LN:133
@SQ SN:RefIdentifier3 LN:189
@SQ SN:RefIdentifier4 LN:140
@SQ SN:RefIdentifier5 LN:120
I tried to get some information out of this but couldn't find anything comparable on the web or the manuals so far. So to make it short: I have no clue what to do with that file and why it looks like it does, since the once described elsewhere look completely different, as far as I can tell.

Any help is much appreciated, thanks in advance.

Regards
rboettcher is offline   Reply With Quote
Old 04-14-2011, 02:53 AM   #2
gaffa
Member
 
Location: Gothenburg/Uppsala, Sweden

Join Date: Oct 2010
Posts: 82
Default

That's the SAM header that you're seeing there, with the record type SQ being the sequence dictionary (SN = sequence name, LN = sequence length) of your reference. The read alignments should be below the header in the file (are they? - if not there's a problem).

For more info on the SAM format see the publication http://www.ncbi.nlm.nih.gov/pubmed/19505943 and the format specification http://samtools.sourceforge.net/SAM1.pdf.
gaffa is offline   Reply With Quote
Old 04-14-2011, 03:13 AM   #3
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default

Ok in this case there is a problem, as there are just headers in the file. Unfortunately, I don't get any error messages during the alignment, so I have no idea where to start looking for mistakes. Anyway, thank you for your quick reply.
rboettcher is offline   Reply With Quote
Old 04-18-2011, 03:21 AM   #4
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default

Solved, I reinstalled BWA and retried the alignment after indexing the whole reference again and it worked, no idea what went wrong in the first place...

Thanks anyways.
rboettcher is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off



All times are GMT -8. The time now is 06:47 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO