SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics
Similar Threads
Thread Thread Starter Forum Replies Last Post
Problems with BWA XA output on kbhit General 1 02-29-2012 01:16 PM
Question on BWA output rboettcher Bioinformatics 3 04-18-2011 03:21 AM
bwa output scami Bioinformatics 1 12-22-2010 02:10 AM
BWA output interepretation seq_GA Bioinformatics 4 06-14-2010 12:23 AM
output all possible match using bwa mingkunli Bioinformatics 2 09-05-2009 08:06 AM

Reply
 
Thread Tools
Old 09-21-2011, 12:52 PM   #1
milkingroom
Junior Member
 
Location: NY

Join Date: Jul 2010
Posts: 1
Default the output of bwa

Hi all

I am trying to use the bwa for RNA-seq alignment, but looks like it reports all the reads without filtering the unmapped reads. I can't find any parameter related to filtering the unmapped reads. Does anyone try that before? Or we have to write a script to extract the aligned reads? Also, the format of the bwa generated sam file is bit different from the one I got from tophat. The output sam is shown:
D3B4KKQ1_0166:6:1101:2368:2227#NNNNAN 4 * 0 0 * * 0 0 ATTACTTGGAAACACCGGGATCATATGATTGTTCAATGAAGAAGCACGTCTGAT *

I am confused about
(4 * 0 0 * * 0 0)
Could you help me figure out the meaning of each item?

I am really grateful if anyone can provide me the related information!!
milkingroom is offline   Reply With Quote
Old 09-21-2011, 01:48 PM   #2
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

This is an unmapped read (see the SAM format).
nilshomer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off



All times are GMT -8. The time now is 07:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO