SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Zygosity difference oyvindbusk Bioinformatics 3 01-31-2012 06:56 AM
difference fpkm_tracking file Trudy RNA Sequencing 0 12-19-2011 07:19 AM
Nextera problem:Fragment size control Kitty Sample Prep / Library Generation 2 08-07-2011 10:52 AM
Difference between TopHat and PASS charlie_sequencing Bioinformatics 6 02-04-2011 06:18 AM
Survey:what kind of software do you mostly use for MeDIP analyzing? lqscici Bioinformatics 0 04-25-2010 02:49 PM

Reply
 
Thread Tools
Old 01-19-2010, 01:34 AM   #1
lvxiaobao
Junior Member
 
Location: guangzhou city ,guangdong province ,china

Join Date: Oct 2009
Posts: 6
Default HELP:difference between SE1 and PE1 adapter

SE1 5'-ACACTCTTTCCCTACACGACC-TCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3',
and
SE2 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
PE2 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

as you can see, se2 and pe2 adapter are identical, what the use of se1? because both se2 and pe2 can't mathce se1 exactly?
thanks!
lvxiaobao is offline   Reply With Quote
Old 01-19-2010, 03:36 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Unless you use [ code ] and [ /code ] round a sequence example, the forum will often format it in a funny way (e.g. inserting spaces for line breaks).

Is this what you meant?
Code:
SE1 5'-ACACTCTTTCCCTACACGACC-TCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
and
Code:
SE2 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
PE2 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
maubp is offline   Reply With Quote
Old 01-19-2010, 06:47 PM   #3
lvxiaobao
Junior Member
 
Location: guangzhou city ,guangdong province ,china

Join Date: Oct 2009
Posts: 6
Default

yes, it,s what i mean.
i read the paper "Accurate Whole Human Genome Sequencing using Reversible Terminator Chemistry" of Bentley and found he use the same PE1 adapter in both single read and paired read libaries, then my question is :when should we use se1? se1 is just lack of "c" compared with pe1?
thanks!
lvxiaobao is offline   Reply With Quote
Old 01-25-2010, 02:06 PM   #4
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default

Quote:
Originally Posted by lvxiaobao View Post
yes, it,s what i mean.
i read the paper "Accurate Whole Human Genome Sequencing using Reversible Terminator Chemistry" of Bentley and found he use the same PE1 adapter in both single read and paired read libaries, then my question is :when should we use se1? se1 is just lack of "c" compared with pe1?
thanks!
There is no reason to use the SE adapters in your library prep, since PE adapters can also be used on a SE flow cell. Using PE adapters gives you maximum flexibility to decide between an SE or PE run. I've bolded the identical sections of the adapters for clarity below:


Code:
SE1 5'-ACACTCTTTCCCTACACGACC-TCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'

SE2 3'-GTTCGTCTTCTGCCGTATGCTCGAGAAGGCTAG-p-5'
PE2 3'-GAGCCGTAAGGACGACTTGGC GAGAAGGCTAG-p-5'
greigite is offline   Reply With Quote
Old 01-26-2010, 06:07 AM   #5
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Quote:
Originally Posted by lvxiaobao View Post
yes, it,s what i mean.
i read the paper "Accurate Whole Human Genome Sequencing using Reversible Terminator Chemistry" of Bentley and found he use the same PE1 adapter in both single read and paired read libaries, then my question is :when should we use se1? se1 is just lack of "c" compared with pe1?
thanks!
I think you are mistaken. Looking at the paper you cite, on page 1 of the Supplementary Information the sequences for SE oligo 1 and PE oligo 1 are identical. Did you copy those sequences for the original Supplementary Information or from a secondary source? (By the way, the oligo you typed is missing a 'G', not a 'C'.)
kmcarr is offline   Reply With Quote
Old 01-26-2010, 07:14 AM   #6
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Quote:
Originally Posted by kmcarr View Post
(By the way, the oligo you typed is missing a 'G', not a 'C'.)
I'd spotted that - it is just the gap character is in the wrong place:
Code:
SE1 5'-ACACTCTTTCCCTACACGACC-TCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
this way makes it clearer a G is missing:
Code:
SE1 5'-ACACTCTTTCCCTACACGAC-CTCTTCCGATC*T-3'
PE1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3'
maubp is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:11 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO