SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Consensus FASTA from BAM files mixter Bioinformatics 14 05-19-2014 09:07 AM
Questions about generating consensus sequences from the VCF file sulicon Bioinformatics 1 07-24-2012 06:47 AM
Generating vcf files with samtools Brittd Bioinformatics 1 06-05-2012 11:41 PM
Generating SFF files Xterra 454 Pyrosequencing 8 10-31-2011 01:07 PM
Generating a BAM file from Illumina export files in CASAVa 1.7 nirav99 Bioinformatics 1 09-10-2010 01:20 AM

Reply
 
Thread Tools
Old 07-20-2011, 06:33 AM   #1
EmmaB
Junior Member
 
Location: Torquay

Join Date: Jun 2011
Posts: 7
Unhappy Problem generating consensus files

Hello all,

I have been having trouble generating consensus files from sorted BAM files.

I have tried both the mpileup command-

samtools mpileup -uf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/bcftools/bcftools view -cg - | ../samtools-0.1.16/bcftools/vcfutils.pl vcf2fq > 2245cns.fq

and the depreciated pileup command -

samtools pileup -cf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/misc/samtools.pl pileup2fq -D150 > 2245pcns.fastq

Both commands run correctly, however when I look at the fastq file it truncates at line 69857 and the rest of the files is filled with this character ( ~~~~) and random letters, as shown below -

TCCATAAATTTAGTTATTCTGTAAAATTTATATATATTTTTGCTTTTCTGTTAATAACTT
TGTGGAAAATATTAATTATTCTGTTCGGAGGTTTATatt
+
?BBEEEEHNNNNNZZ`ccffiiloru~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Can anyone please explain what may be going on?
I am very new to seq analysis and can't work it out!

Emma
EmmaB is offline   Reply With Quote
Old 07-20-2011, 06:56 AM   #2
EmmaB
Junior Member
 
Location: Torquay

Join Date: Jun 2011
Posts: 7
Default please ignore the last post!

PLease ignore the last post, I have just realised that I have not converted my file to fasta, therefore I still have the quality called in the fastq file!
EmmaB is offline   Reply With Quote
Old 11-09-2012, 01:30 PM   #3
leirhyh
Junior Member
 
Location: Omaha, NE USA

Join Date: Sep 2012
Posts: 3
Default samtools to convert Bam file to consensus sequence

Hi, all:
I tried to covert Bam file to consensus sequence as follow command:

Samtools pileup -cf primatecom-sorted.bam samtools.pl pileup2fq -D100 > primate.fa

error as follows:
the Pileup command has been removed. please use mpileup instead.

according to EmmBB, I tried mpileup. However, I didn't find samtools-0.1.18/bcftools/bcftools.

Could you help me for this matter?

Thank you very much,

Runhua
leirhyh is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:33 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO