SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Problemastic reads quality score distribution by dwgsim yjx1217 Bioinformatics 1 10-08-2012 01:28 PM
SNP quality distribution peaks at 222 from variant call pile elfuser Bioinformatics 0 07-31-2012 11:42 AM
dwgsim usage gprakhar Bioinformatics 18 07-12-2011 08:59 AM
dwgsim -> readnames and quality scores genome Bioinformatics 1 02-16-2011 06:17 PM
Periodical illumina read length distribution after trimming of low-quality bases luxmare General 4 12-20-2010 03:18 PM

Reply
 
Thread Tools
Old 03-21-2013, 03:38 AM   #1
scondo
Junior Member
 
Location: Innsbruck

Join Date: Feb 2013
Posts: 6
Default DWGSIM quality distribution

Hi,

i use the following command for illumina 100 PE read simulation. The problem is that all simulated reads had the same quality score. I want to simulate reads with a raw accuracy of about 99,5%. How i must configure the command line to generate reads with a different quality score?

Command line:
./dwgsim -e 0.001-0.01 -E 0.0025-0.0075 -d 175 -s 75 -1 100 -2 100 -C 1 -r 0.00131 -R 0.09166 -X 0.3 -I 1 -c 0 -S 0 -x /home/.../Dwgsim-input/extended_regions_sort_illumina.bed /home/../Dwgsim-input/ucsc_chr1-22XY.fa Read

Quality score:

@chr1_22158191_22158224_0_1_0_0_5:0:0_40:0:0_1419/1
CCCTGGGTGAGGCGGCGCAGCAGGGTCACGGTGTGGAAATGGCCCAGGGCCAGTGGTGTGGGATAGGGGATGGTGGCCTTGCCTGAGCCTACATCGAACC
+
!@=;:9887666555444333332222211111111000000000///////////...............------------------,,,,,,,,,,,
@chr1_172357618_172357549_1_0_0_0_6:0:0_47:0:0_141a/1
GTGACCTGAGGAAAAAGAGAAATCATAGTTTGCTCACTCCTCCTTTCTGTCTGAACTAATCACTAAAAATGTCTTGTCACTGCCTGCTTTTTAAAAATGA
+
!@=;:9887666555444333332222211111111000000000///////////...............------------------,,,,,,,,,,,
@chr1_153638154_153638289_0_1_0_0_5:0:0_36:0:0_141b/1
GTGCTCTTAGGCTTTCCACGACTTTGTTCCCCAGGGCAGCAACAGGTTCCACTAATTGACAGAAAATGACCTAATGTTATAATAAATTATTTCTCTAGAC
+
!@=;:9887666555444333332222211111111000000000///////////...............------------------,,,,,,,,,,,

Thanks for your help!
scondo is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:08 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO