SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TopHat .sam output format not recognised lindseyjane Bioinformatics 22 02-14-2012 09:04 PM
Normal size of .sam output file from Tophat GiladZil RNA Sequencing 0 07-04-2011 08:02 AM
tophat 1.3.0 sam output quality string problem jameslz Bioinformatics 4 06-16-2011 05:22 PM
sam format version in tophat output tangx_2010 RNA Sequencing 2 03-15-2011 06:28 PM
tophat - cannot view sam output in samtools tview lmilne Bioinformatics 2 12-01-2009 12:13 PM

Reply
 
Thread Tools
Old 04-29-2010, 11:51 AM   #1
darked89
Member
 
Location: Barcelona, Spain

Join Date: Jun 2009
Posts: 36
Question splicing stats from Tophat's SAM output

Hi,

I just want tocheck thifat this is the right way to do it.

problem:
Using Tophat output (accepted_hits.sam) calculate statistics about spliced vs non_spliced hits.

Spliced reads looks like this:
8_105_178_344 0 scaffold09041 94954 255 9M7543N41M * 0 0 CAGTTAATTTCTGCGAACCGAAGATAACAACAGTGATAAGGGTCGCTACTAA BABBBBBBABA@BBBBBB@<B@@4>@A@0<0:?37<=999.<9=4<?7%2 NM:i:0 XS:A:- NS:i:0

solution:
grab CIGAR string "9M7543N41M", anything with number before N larger than minimal intron size (50 by default) should be a spliced read.

Is this correct?

Darek Kedra
darked89 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO