SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
small RNA cleanup for Illumina library prep eab Sample Prep / Library Generation 17 02-27-2015 08:38 AM
Small RNA Sample Prep v1.5.0 jujuhi Illumina/Solexa 19 11-21-2011 10:10 PM
Problems with Invitrogen Size Select E-gels for Illumina RNA-Seq Library Sample Prep? Jerry Glenn Sample Prep / Library Generation 0 04-18-2011 07:14 AM
Small RNA sample prep images Kaisee RNA Sequencing 0 10-28-2010 12:59 PM
small DNA sample library prep vlee2 454 Pyrosequencing 3 05-22-2009 11:55 AM

Reply
 
Thread Tools
Old 05-21-2010, 12:10 PM   #1
won337
Junior Member
 
Location: USA

Join Date: May 2010
Posts: 1
Default illumina small RNA sample prep v1.5

Hi guys-

Using the new illumina small RNA sample prep kit v1.5, do we expect an additional "A" right after the miRNA sequence?

Here is the original 3' RNA Adaptor sequence and result library and I added the red colored "A":
3' RNA Adapter
5' P-AUCGUAUGCCGUCUUCUGCUUGUidT
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATC (N) ATCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAG (N) TAGCATACGGCAGAAGACGAA C 5'



I suspect that illumina improved the new kit using pre–5',5'-adenylated adaptor, so the adaptor ligation can be performed in absence of ATP. However, I am not able to find such a reference. If you have one, please let me know.

Plus, are there any biases observed using this new kit?
won337 is offline   Reply With Quote
Old 05-27-2010, 04:42 PM   #2
link1
Member
 
Location: US

Join Date: May 2010
Posts: 21
Default

hi,
the 3' adapter sequence for small RNA sequencing, v1.5 is ATCTCGTATGCCGTCTTCTGCTTG. You'll need it to be 5'adenylated and 3'ddC blocked. You are right the 3' ligation does not require ATP and can be performed with T4 RNA Ligase 2, truncated.

I've tried to order this kit from Illumina but they are out of stock. I've been very happy with the small RNA Sequencing kit from Bioo Scientific. It includes all the components you need.

Last edited by link1; 05-27-2010 at 06:59 PM.
link1 is offline   Reply With Quote
Old 04-28-2011, 03:37 PM   #3
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

Quote:
Originally Posted by link1 View Post
hi,
the 3' adapter sequence for small RNA sequencing, v1.5 is ATCTCGTATGCCGTCTTCTGCTTG. You'll need it to be 5'adenylated and 3'ddC blocked. You are right the 3' ligation does not require ATP and can be performed with T4 RNA Ligase 2, truncated.

I've tried to order this kit from Illumina but they are out of stock. I've been very happy with the small RNA Sequencing kit from Bioo Scientific. It includes all the components you need.
Ok, 3' adaptor with the 5'adenilated doesn't need ATP in the ligation reaction. But, what if you use a ligation buffer with ATP??

Thanks.
cascoamarillo is offline   Reply With Quote
Old 05-06-2011, 09:45 AM   #4
Bioo Scientific
Registered Vendor
 
Location: Austin, Tx

Join Date: Oct 2009
Posts: 99
Default

Hi Cascoamarillo,

Using a buffer with ATP allows your small RNA insert to non-specifically bind to other small RNAs, and genomic material in your sample. By eliminating ATP in the 3’ligation step you ensure that your adenylated adapter is the only thing that’s ligating to your sample.
Bioo Scientific is offline   Reply With Quote
Old 05-12-2011, 08:16 PM   #5
silin284
Member
 
Location: ny

Join Date: Jul 2009
Posts: 23
Default

if u use ligation buffer with ATP, u will circulate all ur small RNA rather than ligating them to 3SR linkers. Because sRNA, at least in plants, have 5' PO4 and 3'OH. I thought the 3' linker is a DNA molecule with 5' App (adenylation). T4 RNL2 trun can't use a 5' phosphate.
silin284 is offline   Reply With Quote
Old 05-16-2011, 12:18 PM   #6
Bioo Scientific
Registered Vendor
 
Location: Austin, Tx

Join Date: Oct 2009
Posts: 99
Default

Hi Silin284,

The 3’ linker or adapter is an adenylated DNA oligonucleotide that will specifically bind to the OH groups of RNA when used in the presence of truncated T4 RNA Ligase. ATP in the reaction would cause a lot of non-specific binding.

Last edited by Bioo Scientific; 03-31-2015 at 06:59 AM. Reason: The link was bad
Bioo Scientific is offline   Reply With Quote
Old 03-31-2015, 04:58 AM   #7
qubianka
Junior Member
 
Location: Warsaw, Poland

Join Date: Mar 2015
Posts: 2
Default ligate 3' adapter

Does anyone use T4 RNA ligase instead mutated to ligate 3' adapter?
qubianka is offline   Reply With Quote
Old 03-31-2015, 07:02 AM   #8
Bioo Scientific
Registered Vendor
 
Location: Austin, Tx

Join Date: Oct 2009
Posts: 99
Default

Hi Quibianka,

We use T4 RNA Ligase (not truncated) to ligate the 5’adapter. /
Bioo Scientific is offline   Reply With Quote
Reply

Tags
illumina, rna prep kit, small rna

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:18 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO