SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Sorting fastq by primers, then searching by sequence (with mismatches) jme Bioinformatics 0 01-18-2012 09:25 AM
bisulfite sequencing and cluster detection dawe Illumina/Solexa 7 11-16-2011 02:39 AM
Any advice on RNA bisulfite sequencing? mboth Sample Prep / Library Generation 1 10-06-2011 07:49 AM
ChIP-Seq and Bisulfite sequencing coverage flobpf Epigenetics 2 05-03-2010 01:29 PM
Help with bisulfite sequencing aniruddha.otago Epigenetics 1 02-03-2010 07:26 AM

Reply
 
Thread Tools
Old 08-07-2010, 07:17 AM   #1
aleferna
Senior Member
 
Location: sweden

Join Date: Sep 2009
Posts: 121
Default Searching for Bisulfite sequencing primers

This is a really silly question, but I'm trying to find out the location of a primer in the original genome but I can't find them.

If I have the following sequence how can I find where it came from?
GGTTAGGTGAAGGTTTTGTGGGTAGTTATA
aleferna is offline   Reply With Quote
Old 08-07-2010, 08:39 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

You could just run your primer sequence of interest through a bisulfite mapping pipeline. We use a program called Bismark which is pretty straight forward to use (http://seqanswers.com/forums/showthr...hlight=bismark). All associated files can be downloaded from http://www.bioinformatics.bbsrc.ac.uk/projects/.

You would have to index your genome of interest first which might take a while though. If you don't want to go through all the hassle you can just send me an email with the genome build you are interested in (human, mouse....) and I will try to find the location for you on Monday morning. My email address is felix.krueger@bbsrc.ac.uk.

Best wishes,
Felix
fkrueger is offline   Reply With Quote
Old 08-09-2010, 12:24 AM   #3
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

Dear Aleferna,

I just used Bismark to determine the binding position of your unknown bisulfite oligo. There are no unique alignments to the human genome builds NCBI36 or GRCh37, but several ambiguous alignments with 2 or more mismatches.

However alignment to the mouse genome (build NCBIM37) gives a perfect match:

unknown_oligo
- (alignment orientation)
7 (chromosome)
149851590 (alignment start)
149851619 (alignment end)
GGTTAGGTGAAGGTTTTGTGGGTAGTTATA (your sequence of interest)
GGTCAGGTGAAGGCTCTGTGGGCAGCCACA
(genomic equivalent sequence)
...c.........c.c......c..cc.c. (methylation call (lower case c indicates converted cytosines))


I hope that the organism you are working with is indeed mouse. If you need anything else don't hesitate to contact me.
fkrueger is offline   Reply With Quote
Old 08-09-2010, 03:17 AM   #4
aleferna
Senior Member
 
Location: sweden

Join Date: Sep 2009
Posts: 121
Default

Hey thanks yes its the mouse actually, thats exactly what I was looking for!
aleferna is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO