
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
PubMed: Looking ultra deep: short identical sequences and transcriptional slippage. Newsbot! Literature Watch 0 11-16-2011 02:00 AM
Blat parameters for mapping short sequences clatrinajes Bioinformatics 2 05-19-2011 03:28 AM
mixing long and short sequences francesco.vezzi De novo discovery 1 05-19-2010 09:10 AM
MAQ and BOWTIE, reads' positions different? dukevn Bioinformatics 14 11-25-2009 12:23 PM
PubMed: PASS: a Program to Align Short Sequences. Newsbot! Bioinformatics 0 02-17-2009 05:00 AM

Thread Tools
Old 01-14-2011, 07:33 AM   #1
Location: Stockholm, Sweden

Join Date: Oct 2009
Posts: 62
Default Bowtie problem when mapping against short sequences, no positions.

Hi All,

I want to use Bowtie to align reads to exons and junctions. I have created fasta files of the junctions and exons, indexed them and so on. When I run bowtie I end up with aligned reads without mapping information.

WICMT-SOLEXA_100421_61T4HAAXX:6:25:11235:11821#0/1;0	4	*	0	0	*	*	0	0	CGGGGCATAGGGGTACTTCTCAAGTGGGGAATGCCATATGAAGTGGAGCATACATGGGGGCACACAATTCCA@#######################################################################	XM:i:0
I know that spaces and pipes in the reference names can be a problem, so I don't have those in my names. The reference names are however quite long (chr1:196945439-196945639:+:ENSG00000081237 and similar). Names such as ENSG00000081237_1_196945439_196945639 makes no difference.

I'm using bowtie version 0.12.7.

Would truly appreciate some help!

Last edited by Boel; 01-14-2011 at 08:15 AM. Reason: typo
Boel is offline   Reply With Quote
Old 01-14-2011, 08:54 AM   #2
Location: Stockholm, Sweden

Join Date: Oct 2009
Posts: 62
Default Problem solved.

The flag is 4 = unmapped reads.

Unable to delete my first message - sorry about that.
Boel is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 07:39 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO