Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • fastx: fastq_quality_filter

    Hello,
    I used fastq_quality_filter to remove reads that had quality scores below 30 from a fastq file. The encoding of the quality scores, according to fastqc, is "Sanger / Illumina 1.9". The command I used was: fastq_quality_filter -Q 33 -q 30 -p 100 -i in.fastq -o out.fastq. I ran fastqc before and after the filtering. After filtering with fastq_quality_filter, fastqc reports that the quality encoding changed to Illumina < 1.3. Furthermore, the range of quality scores changes from 28-40 to ~4-16. According to fastqc, fastq_quality_filter is converting the original Sanger/lumina 1.9 encoding to illumina <1.3 encoding. How can I be sure fastq_quality_filter is removing the correct reads? I've attached png's of fastqc output before and after fastq_quality_filtering. Thanks a bunch.
    Click image for larger version

Name:	per_base_quality_Unfiltered.png
Views:	1
Size:	8.9 KB
ID:	307848

    Click image for larger version

Name:	per_base_quality_fastqFiltered.png
Views:	1
Size:	8.5 KB
ID:	307849


    example read from fastq file:
    @HWI-ST570:48:C0NUKACXX:3:1308:18173:180116 1:N:0:
    CGAGCTGGTGCGAACCAAGACCTTGGTGAAGAACAGCATCGTGGTCATCG
    +
    CCCFFFFFHHHHHIJJJJJJJJJJJJHIJJJJJGIIIJIJJIJJHIJJJJ

  • #2
    I met the same problem!

    Originally posted by daiello View Post
    Hello,
    I used fastq_quality_filter to remove reads that had quality scores below 30 from a fastq file. The encoding of the quality scores, according to fastqc, is "Sanger / Illumina 1.9". The command I used was: fastq_quality_filter -Q 33 -q 30 -p 100 -i in.fastq -o out.fastq. I ran fastqc before and after the filtering. After filtering with fastq_quality_filter, fastqc reports that the quality encoding changed to Illumina < 1.3. Furthermore, the range of quality scores changes from 28-40 to ~4-16. According to fastqc, fastq_quality_filter is converting the original Sanger/lumina 1.9 encoding to illumina <1.3 encoding. How can I be sure fastq_quality_filter is removing the correct reads? I've attached png's of fastqc output before and after fastq_quality_filtering. Thanks a bunch.
    [ATTACH]1517[/ATTACH]

    [ATTACH]1518[/ATTACH]


    example read from fastq file:
    @HWI-ST570:48:C0NUKACXX:3:1308:18173:180116 1:N:0:
    CGAGCTGGTGCGAACCAAGACCTTGGTGAAGAACAGCATCGTGGTCATCG
    +
    CCCFFFFFHHHHHIJJJJJJJJJJJJHIJJJJJGIIIJIJJIJJHIJJJJ
    Hi daiello,
    Have you find the possible reason and solution for this problem ?
    Whether this affects the outcome of next steps such as mapping or de novo assembly?
    I met the same problem too, and I'm wondering if it is an error of fastqc but not association with the Fastq_quality_filter ?

    Comment


    • #3
      Without directly answering your question, I have found FASTQ to be finicky and glitchy...
      Use PRINSEQ either online or from the terminal

      Comment


      • #4
        This thread was almost a year old. You could have started a new one.

        Still, for the sake of some answer. From the information provided, I would say it is just the FastQC software misinterpreting the quality scores. In my experience fastq_quality_filter does not convert quality scores into a different encoding. But what could happen if you discard all qualities below thirty (by chance even all below 33), is that FastQC won't find out of range quality scores and therefore misinterprets them as Illumina 1.3 instead of 1.9.

        Therefore don't bother in your downstream application and have faith that the quality offset stays the same

        If you need the graphs of FastQC there is most probably a setting to enforce -Q33.

        EDIT: misread the date, was not "over a year old", but "almost a year old"
        Last edited by sisch; 05-28-2013, 03:40 AM.

        Comment


        • #5
          Originally posted by sisch View Post
          This thread was almost a year old. You could have started a new one.

          Still, for the sake of some answer. From the information provided, I would say it is just the FastQC software misinterpreting the quality scores. In my experience fastq_quality_filter does not convert quality scores into a different encoding. But what could happen if you discard all qualities below thirty (by chance even all below 33), is that FastQC won't find out of range quality scores and therefore misinterprets them as Illumina 1.3 instead of 1.9.

          Therefore don't bother in your downstream application and have faith that the quality offset stays the same

          If you need the graphs of FastQC there is most probably a setting to enforce -Q33.

          EDIT: misread the date, was not "over a year old", but "almost a year old"
          Thanks for your suggestion.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM
          • seqadmin
            Current Approaches to Protein Sequencing
            by seqadmin


            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
            04-04-2024, 04:25 PM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Yesterday, 08:47 AM
          0 responses
          12 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-11-2024, 12:08 PM
          0 responses
          60 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 10:19 PM
          0 responses
          59 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 09:21 AM
          0 responses
          54 views
          0 likes
          Last Post seqadmin  
          Working...
          X