SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
FASTX Toolkit barcode splitter issue jdanderson Bioinformatics 36 01-31-2016 06:09 PM
FastX-toolkit liu_xt005 Bioinformatics 13 10-11-2014 04:52 AM
FASTX-Toolkit: quality score value thinkRNA Bioinformatics 13 09-30-2014 09:25 AM
Fastx Toolkit for Quality Stats of data from new illumina pipeline software vedbar Bioinformatics 6 09-19-2011 09:50 AM
SCS/RTA upgrade Q-score of 41 fastx toolkit crash seqfast Bioinformatics 1 08-22-2011 07:15 AM

Reply
 
Thread Tools
Old 06-04-2010, 01:55 AM   #1
Lspoor
Member
 
Location: Fife, Scotland

Join Date: Mar 2010
Posts: 18
Question Newbie questions regarding Illumina read quality statistics using FASTX toolkit

I'm pretty new to NGS. I have Illumina GAII 36bp paired reads for several bacterial genomes. The sequencing was carried out in one run, using 2 lanes.
I have been using FASTX toolkit to produce quality statistics of both sets of reads of each isolate from the Solexa fastq files. From that output, a boxplot and nucleotide distribution graph for each set of reads of each isolate has been produced which has prompted 2 main questions:

1. In the boxplot, it plots the median quality scores against nucleotide position. For both sets of reads for all isolates for all 36bp, the median score is 34. Is it normal to get this much consistency? I had been told that the median score tends to tail off a bit lower towards the 3' end of the read.

2. For each 36bp position of the reads the graph shows the ACGT nucletide distribution. According to the nucleotide distribution graph, for each set of reads for every isolate, the first 3 nucleotide positions are skewed in comparison to the rest of the read. I believe it should be fairly constant, reflecting all the reads covering the whole genome.
Is this due to adaptor contamination? Again, is it normal to get this sort of consistency?

The bacteria are closely related and the sequencing was carried out in one run. Consequently I have trimmed the first 3 nucleotides from each read prior to assembly against a reference genome.

I'd be grateful if anyone can explain what I'm seeing here?
Lspoor is offline   Reply With Quote
Old 06-21-2010, 10:05 PM   #2
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Hi,
I am trying to use FASTX for illumina reads. Can you please tell me which version to download from http://codex.cshl.org/labmembers/gor.../download.html and the steps involved. I assume that its better to download fastx_toolkit-0.0.11.tar.bz2 and libgtextutils-0.5.tar.bz2 as its the latest version.
I am interested in plotting atgc distribution. Thanks.
seq_GA is offline   Reply With Quote
Old 06-21-2010, 11:42 PM   #3
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Hi,
I am still trying to use FASTX for illumina reads and my objective is to draw box plots and draw nucleotide distribution.
1. I downloaded precompiled from Linux (64bit),http://hannonlab.cshl.edu/fastx_toolkit/download.html


2. I want to try as below in the website and I am getting the following error:

Code:
a)   $ ./fastx_quality_stats -i /solexa/data/s_5_1_sequence.txt  -o /solexa/data/s_5_1_stats.txt 

b)  $ sh fastx_nucleotide_distribution_graph.sh   -i /solexa/data/s_5_
1_stats.txt -o /solexa/data/s_5_1_distri.png -t "My Library"


 line 0: undefined variable: vertical

         line 0: undefined variable: invert


gnuplot> set style histogram rowstacked 
                   ^
         line 0: expecting 'data', 'function', 'line', 'fill' or 'arrow'


gnuplot> set style data histograms 
                                   ^
         line 0: expecting 'lines', 'points', 'linespoints', 'dots', 'impulses',
        'yerrorbars', 'xerrorbars', 'xyerrorbars', 'steps', 'fsteps',
        'histeps', 'filledcurves', 'boxes', 'boxerrorbars', 'boxxyerrorbars',
        'vectors', 'financebars', 'candlesticks', 'errorlines', 'xerrorlines',
        'yerrorlines', 'xyerrorlines', 'pm3d'

         line 0: undefined function: xtic

When I open my stats file produced during the first step, I didnot see any error. Here is my head of stats file generated:

Code:
 head s_5_1_stats.txt 
column  count   min     max     sum     mean    Q1      med     Q3      IQR     lW      rW      A_Count C_Count G_Count T_Count N_Count  Max_count
1       34831800        2       35      1167973413      33.53   34      34      34      0       34      34      9717028 8225908 8411883  8370604 106377  34831800
2       34831800        2       35      1166982783      33.50   34      34      34      0       34      34      9722780 7405910 8637580  9065309 221     34831800
3       34831800        2       35      1166744486      33.50   34      34      34      0       34      34      9327988 7829625 8363455  9310732 0       34831800
4       34831800        2       35      1166560776      33.49   34      34      34      0       34      34      9337611 7742389 8855551  8896249 0       34831800
5       34831800        2       35      1165922020      33.47   34      34      34      0       34      34      9507407 7760322 8371000  9193071 0       34831800
6       34831800        2       35      1166684479      33.49   34      34      34      0       34      34      9311222 8311632 8348617  8860329 0       34831800
7       34831800        2       35      1166443105      33.49   34      34      34      0       34      34      9280435 8093156 8125314  9332895 0       34831800
8       34831800        2       35      1166644279      33.49   34      34      34      0       34      34      9166913 8244889 7982211  9437787 0       34831800
9       34831800        2       35      1166241221      33.48   34      34      34      0       34      34      9114496 8321642 7959958  9435588 116     34831800
Can I start using solexa fastq data directly? Thx.
seq_GA is offline   Reply With Quote
Old 06-22-2010, 05:26 AM   #4
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Quote:
Originally Posted by Lspoor View Post
I'm pretty new to NGS. I have Illumina GAII 36bp paired reads for several bacterial genomes. The sequencing was carried out in one run, using 2 lanes.
I have been using FASTX toolkit to produce quality statistics of both sets of reads of each isolate from the Solexa fastq files. From that output, a boxplot and nucleotide distribution graph for each set of reads of each isolate has been produced which has prompted 2 main questions:

1. In the boxplot, it plots the median quality scores against nucleotide position. For both sets of reads for all isolates for all 36bp, the median score is 34. Is it normal to get this much consistency? I had been told that the median score tends to tail off a bit lower towards the 3' end of the read.

2. For each 36bp position of the reads the graph shows the ACGT nucletide distribution. According to the nucleotide distribution graph, for each set of reads for every isolate, the first 3 nucleotide positions are skewed in comparison to the rest of the read. I believe it should be fairly constant, reflecting all the reads covering the whole genome.
Is this due to adaptor contamination? Again, is it normal to get this sort of consistency?

The bacteria are closely related and the sequencing was carried out in one run. Consequently I have trimmed the first 3 nucleotides from each read prior to assembly against a reference genome.

I'd be grateful if anyone can explain what I'm seeing here?
I don't know that I can explain it but I can reassure you that what you are seeing is not out of the ordinary.

1. In a decent run you will not see significant decrease in the median Q score over only 36 cycles. In recent versions of their base caller Illumina caps the Q score at 34 and it seems the majority of its bases meet this level. (I think they're being a little generous with themselves but that's just one man's opinion.)

2. I very often see slight deviations in the base call composition over the first 2-3 cycles so you are not alone. There are two basic possibilities: the abnormal distribution is a true representation of the the DNA sequence meaning that the fragmentation or selection of fragments for library preparation is not strictly random; or the observation is due to some artifact of the sequencing or data analysis. I think the first possibility can be ruled out because I observed the bias in libraries fragmented both by nebulizer and by Covaris. It seem highly unlikely that two completely different fragmentation methods would produce the same non-random result. Also, I found that degree of bias in the first couple of cycles reduced dramatically in the shift from pipeline v1.3 to pipeline 1.4 (or maybe it was 1.4 to 1.5).

I used to remove bases from the first 2 cycles as you did but I stopped doing this after the change in the pipeline mitigated the problem. Do you know which pipeline (or RTA) version was used to call the bases?
kmcarr is offline   Reply With Quote
Old 08-30-2010, 04:10 AM   #5
Mark Ott
Junior Member
 
Location: Germany

Join Date: Aug 2010
Posts: 1
Default

Hello, being a new user of FASTX I was running into the same error message mentioned above by seq_GA.
Do you know the answer how to resolve this issue?
Many thanks!


a) $ ./fastx_quality_stats -i /solexa/data/s_5_1_sequence.txt -o /solexa/data/s_5_1_stats.txt

b) $ sh fastx_nucleotide_distribution_graph.sh -i /solexa/data/s_5_
1_stats.txt -o /solexa/data/s_5_1_distri.png -t "My Library"


line 0: undefined variable: vertical

line 0: undefined variable: invert


gnuplot> set style histogram rowstacked
^
line 0: expecting 'data', 'function', 'line', 'fill' or 'arrow'


gnuplot> set style data histograms
^
line 0: expecting 'lines', 'points', 'linespoints', 'dots', 'impulses',
'yerrorbars', 'xerrorbars', 'xyerrorbars', 'steps', 'fsteps',
'histeps', 'filledcurves', 'boxes', 'boxerrorbars', 'boxxyerrorbars',
'vectors', 'financebars', 'candlesticks', 'errorlines', 'xerrorlines',
'yerrorlines', 'xyerrorlines', 'pm3d'

line 0: undefined function: xtic
Mark Ott is offline   Reply With Quote
Old 02-24-2011, 06:08 PM   #6
upendra_35
Senior Member
 
Location: USA

Join Date: Apr 2010
Posts: 102
Default

Quote:
Originally Posted by Mark Ott View Post
Hello, being a new user of FASTX I was running into the same error message mentioned above by seq_GA.
Do you know the answer how to resolve this issue?
Many thanks!


a) $ ./fastx_quality_stats -i /solexa/data/s_5_1_sequence.txt -o /solexa/data/s_5_1_stats.txt

b) $ sh fastx_nucleotide_distribution_graph.sh -i /solexa/data/s_5_
1_stats.txt -o /solexa/data/s_5_1_distri.png -t "My Library"


line 0: undefined variable: vertical

line 0: undefined variable: invert


gnuplot> set style histogram rowstacked
^
line 0: expecting 'data', 'function', 'line', 'fill' or 'arrow'


gnuplot> set style data histograms
^
line 0: expecting 'lines', 'points', 'linespoints', 'dots', 'impulses',
'yerrorbars', 'xerrorbars', 'xyerrorbars', 'steps', 'fsteps',
'histeps', 'filledcurves', 'boxes', 'boxerrorbars', 'boxxyerrorbars',
'vectors', 'financebars', 'candlesticks', 'errorlines', 'xerrorlines',
'yerrorlines', 'xyerrorlines', 'pm3d'

line 0: undefined function: xtic
I don't know much about the errors above but what i can suggest is to do the fastxquality stats on the command line in Unix and then uploaded the txt file on to galaxy (http://main.g2.bx.psu.edu/).
(get data ---> upload file), 
you can generate the quality score box plot graph (Graph/Display Data ---> Boxplot) 
and visualize the nucleotide distribution graph in the same manner. Used default parameters for boxplot.

Good luck
upendra_35 is offline   Reply With Quote
Old 02-24-2011, 10:58 PM   #7
ulz_peter
Senior Member
 
Location: Graz, Austria

Join Date: Feb 2010
Posts: 219
Default

Hi all,

Why not try the great FastQC program. Comes with a nice GUI and great visualization.
Worth a try...
ulz_peter is offline   Reply With Quote
Old 02-24-2011, 11:31 PM   #8
ulz_peter
Senior Member
 
Location: Graz, Austria

Join Date: Feb 2010
Posts: 219
Default

Forgot to post the link:

http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
ulz_peter is offline   Reply With Quote
Old 02-25-2011, 04:50 PM   #9
upendra_35
Senior Member
 
Location: USA

Join Date: Apr 2010
Posts: 102
Default

I have tried FastQC and it is quite good as it does most of the quality scoring stuff. The only graphic or quality checking that is missing is nucleotide distribution across each read which you can only do it either in Fastax or Galaxy.
upendra_35 is offline   Reply With Quote
Old 03-04-2011, 12:22 PM   #10
flobpf
Member
 
Location: USA

Join Date: Apr 2010
Posts: 76
Default Maybe not...

Quote:
Originally Posted by upendra_35 View Post
I have tried FastQC and it is quite good as it does most of the quality scoring stuff. The only graphic or quality checking that is missing is nucleotide distribution across each read which you can only do it either in Fastax or Galaxy.
Maybe this feature was not present in the old version. But atleast the one I am using gives a plot showing %A,%T,%C,%G at each position across all the reads. The image is named "per_base_sequence_content.png"
flobpf is offline   Reply With Quote
Old 09-12-2011, 08:35 PM   #11
son_nexg
Junior Member
 
Location: Australia

Join Date: Jul 2011
Posts: 8
Default

Hi guys,

I want to use 'fastx_quality_stats' for my illumina data but it gives the following error:

fastx_quality_stats -i /PATH/Sample_XX.fastq -o /PATH/Sample_xx.fastq.stats
fastx_quality_stats: Invalid quality score value (char '#' ord 35 quality value -29) on line 4



This is how my fastq file looks like:

head -4 /PATH/Sample_xx.fastq
@HWI-ST212:160:AB01NFABXX:4:1101:1355:2086 1:N:0:ATCACG
CGGGAAGTATGTACACGGGGTACGTGCCAAGCATCCTCGCGCGACCCCGAGAGCCTGGGGAGCGGGGGCTTGCCGGCCGT CGCACTCATTTACCCGGAGAC
+
HHHHHHHHHHHHHHHHHHHHHHFHHHHHHBHFHHHGHFHHHHHHHHHHHHHHHHHHHHHHEHHHHHHFEH?EEBFEDEE< >>5:ADC>CFE2CDEAD####


I'd appreciate any help I can get with this.

Thanks a lot!!
son_nexg is offline   Reply With Quote
Old 09-13-2011, 03:18 AM   #12
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 628
Default

Quote:
Originally Posted by son_nexg View Post
Hi guys,

I want to use 'fastx_quality_stats' for my illumina data but it gives the following error:

fastx_quality_stats -i /PATH/Sample_XX.fastq -o /PATH/Sample_xx.fastq.stats
fastx_quality_stats: Invalid quality score value (char '#' ord 35 quality value -29) on line 4



This is how my fastq file looks like:

head -4 /PATH/Sample_xx.fastq
@HWI-ST212:160:AB01NFABXX:4:1101:1355:2086 1:N:0:ATCACG
CGGGAAGTATGTACACGGGGTACGTGCCAAGCATCCTCGCGCGACCCCGAGAGCCTGGGGAGCGGGGGCTTGCCGGCCGT CGCACTCATTTACCCGGAGAC
+
HHHHHHHHHHHHHHHHHHHHHHFHHHHHHBHFHHHGHFHHHHHHHHHHHHHHHHHHHHHHEHHHHHHFEH?EEBFEDEE< >>5:ADC>CFE2CDEAD####


I'd appreciate any help I can get with this.

Thanks a lot!!
This is new casava 1.8 fastq output; you should use a new version of fastqc for reading these files (There is another thread[1] where there is a link with a development snapshot of fastqc allowing to correctly reads v1.8 fastq files).

hth, Sven

[1]= http://seqanswers.com/forums/showthr...ghlight=fastqc
sklages is offline   Reply With Quote
Old 09-13-2011, 04:41 AM   #13
flobpf
Member
 
Location: USA

Join Date: Apr 2010
Posts: 76
Default

Quote:
Originally Posted by son_nexg View Post
Hi guys,

I want to use 'fastx_quality_stats' for my illumina data but it gives the following error:

fastx_quality_stats -i /PATH/Sample_XX.fastq -o /PATH/Sample_xx.fastq.stats
fastx_quality_stats: Invalid quality score value (char '#' ord 35 quality value -29) on line 4



I'd appreciate any help I can get with this.

Thanks a lot!!
Seems like you may have Sanger quality encoding (### at the end of sequence in FASTQ). Try this:

fastx_quality_stats -i /PATH/Sample_XX.fastq -Q 33 -o /PATH/Sample_xx.fastq.stats
flobpf is offline   Reply With Quote
Old 09-13-2011, 03:23 PM   #14
son_nexg
Junior Member
 
Location: Australia

Join Date: Jul 2011
Posts: 8
Default

Quote:
Originally Posted by flobpf View Post
Seems like you may have Sanger quality encoding (### at the end of sequence in FASTQ). Try this:

fastx_quality_stats -i /PATH/Sample_XX.fastq -Q 33 -o /PATH/Sample_xx.fastq.stats
Thanks a lot, -Q option worked for me!!

I am now onto the next step and generating the nucleotide distribution graph by doing:

fastx_nucleotide_distribution_graph.sh \
-i /PATH/Sample_xx.fastq.stats \
-o /PATH/Sample_xx.fastq.stats_nuc.png \
-t Sample_xx


But getting the following error:

line 0: undefined variable: vertical

line 0: undefined variable: invert


gnuplot> set style histogram rowstacked
^
line 0: expecting 'data', 'function', 'line', 'fill' or 'arrow'


gnuplot> set style data histograms
^
line 0: expecting 'lines', 'points', 'linespoints', 'dots', 'impulses',
'yerrorbars', 'xerrorbars', 'xyerrorbars', 'steps', 'fsteps',
'histeps', 'filledcurves', 'boxes', 'boxerrorbars', 'boxxyerrorbars',
'vectors', 'financebars', 'candlesticks', 'errorlines', 'xerrorlines',
'yerrorlines', 'xyerrorlines', 'pm3d'

line 0: undefined function: xtic


These are the first 4 lines of my stats file:

column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 12192845 2 40 446955197 36.66 38 39 39 1 37 40 1290565 4112034 5828477 943901 17868 12192845
2 12192845 2 40 441775514 36.23 37 39 39 2 34 40 5245648 1771654 1927735 3247808 0 12192845
3 12192845 2 40 441662699 36.22 37 39 39 2 34 40 2061208 2422450 2202622 5506565 0 12192845


Any guesses what might be happening with the input format?

Cheers!!
son_nexg is offline   Reply With Quote
Old 09-13-2011, 03:27 PM   #15
flobpf
Member
 
Location: USA

Join Date: Apr 2010
Posts: 76
Default

Sorry I dont use FASTX for doing this step. I found FASTQC gives better pictures
flobpf is offline   Reply With Quote
Old 10-26-2011, 06:03 AM   #16
Lspoor
Member
 
Location: Fife, Scotland

Join Date: Mar 2010
Posts: 18
Default

Quote:
Originally Posted by kmcarr View Post
I don't know that I can explain it but I can reassure you that what you are seeing is not out of the ordinary.

1. In a decent run you will not see significant decrease in the median Q score over only 36 cycles. In recent versions of their base caller Illumina caps the Q score at 34 and it seems the majority of its bases meet this level. (I think they're being a little generous with themselves but that's just one man's opinion.)

2. I very often see slight deviations in the base call composition over the first 2-3 cycles so you are not alone. There are two basic possibilities: the abnormal distribution is a true representation of the the DNA sequence meaning that the fragmentation or selection of fragments for library preparation is not strictly random; or the observation is due to some artifact of the sequencing or data analysis. I think the first possibility can be ruled out because I observed the bias in libraries fragmented both by nebulizer and by Covaris. It seem highly unlikely that two completely different fragmentation methods would produce the same non-random result. Also, I found that degree of bias in the first couple of cycles reduced dramatically in the shift from pipeline v1.3 to pipeline 1.4 (or maybe it was 1.4 to 1.5).

I used to remove bases from the first 2 cycles as you did but I stopped doing this after the change in the pipeline mitigated the problem. Do you know which pipeline (or RTA) version was used to call the bases?
Hi kmcarr, Thank you for your reply regarding my questions and apologies for the delayed response. According to the bioinformaticians that also initially quality checked our data this is the reply I received when I asked which RTA version was used:
"The RTA version used to basecall your sequence was version 1.8.70.0. Pipeline software version 1.4 was last used in October 2009."
They think that it might be due to library preparation and the fragmentase used to fragment the sample DNA. Anyhow, I trimmed those first few bases away which improved subsequent mapping, and glad to see that it is not out of the norm!

Thanks,
Laura
Lspoor is offline   Reply With Quote
Old 01-18-2012, 04:23 PM   #17
kasperset
Junior Member
 
Location: US

Join Date: Jan 2012
Posts: 1
Default

/usr/local/bin/fastq_quality_boxplot_graph.sh [-i INPUT.TXT] [-t TITLE] [-p] [-o OUTPUT]

Try to use the "-p" option and it will generate postscript file which can be opened with GSview.



Quote:
Originally Posted by son_nexg View Post
Thanks a lot, -Q option worked for me!!

I am now onto the next step and generating the nucleotide distribution graph by doing:

fastx_nucleotide_distribution_graph.sh \
-i /PATH/Sample_xx.fastq.stats \
-o /PATH/Sample_xx.fastq.stats_nuc.png \
-t Sample_xx


But getting the following error:

line 0: undefined variable: vertical

line 0: undefined variable: invert


gnuplot> set style histogram rowstacked
^
line 0: expecting 'data', 'function', 'line', 'fill' or 'arrow'


gnuplot> set style data histograms
^
line 0: expecting 'lines', 'points', 'linespoints', 'dots', 'impulses',
'yerrorbars', 'xerrorbars', 'xyerrorbars', 'steps', 'fsteps',
'histeps', 'filledcurves', 'boxes', 'boxerrorbars', 'boxxyerrorbars',
'vectors', 'financebars', 'candlesticks', 'errorlines', 'xerrorlines',
'yerrorlines', 'xyerrorlines', 'pm3d'

line 0: undefined function: xtic


These are the first 4 lines of my stats file:

column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 12192845 2 40 446955197 36.66 38 39 39 1 37 40 1290565 4112034 5828477 943901 17868 12192845
2 12192845 2 40 441775514 36.23 37 39 39 2 34 40 5245648 1771654 1927735 3247808 0 12192845
3 12192845 2 40 441662699 36.22 37 39 39 2 34 40 2061208 2422450 2202622 5506565 0 12192845


Any guesses what might be happening with the input format?

Cheers!!
kasperset is offline   Reply With Quote
Old 07-10-2013, 08:10 AM   #18
htetre
Member
 
Location: US

Join Date: Jul 2013
Posts: 28
Default

Hello,

I am trying to download FASTx on a computer cluster and am running into a common problem "No package gtextutil-0.1" found. But when I try to export path to environmental path, i get errors of PKG_CONFIG_PATH: Undefined or errors of export not defined.

What am I doing wrong? I am trying to configure the fastx_toolkit-0.0.13.2.tar.bz2 and libgtextutils-0.6.1.tar.bz2 downloads.

PROBLEM SOLVED!! PLEASE ignore post.

Last edited by htetre; 07-11-2013 at 08:47 AM. Reason: problem solved
htetre is offline   Reply With Quote
Old 09-04-2013, 01:11 PM   #19
Bruss
Junior Member
 
Location: California

Join Date: Jun 2012
Posts: 2
Smile Newbie: Per Base Quality Graphs

I am a NGS newbie as well. I ran FastQC on my raw fastq files and see some that look perfect and some that have small dips in the middle. All stay mostly above 28 (box plot). Are both of these per base quality graphs acceptable? What might cause the dips at 17-19? See attached pdf.
Attached Files
File Type: pdf Per Base Quality Graphs_Illumina.pdf (215.9 KB, 27 views)
Bruss is offline   Reply With Quote
Old 09-05-2013, 05:21 AM   #20
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

@bruss. That sample 35d-1 does indicate problems. Dips in quality near the ends, especially the 3' end, are normal. But that dip in quality at around base 18 and again around base 42 is not good. So you are going to have some reads that are not usable. Depending on your next processing steps these reads may or may not give you problems; i.e., some programs will just ignore them which will be a good thing.
westerman is offline   Reply With Quote
Reply

Tags
illumina fastx boxplot

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:49 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO