SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Anti-enriched Troubleshooting Anthony.287 454 Pyrosequencing 11 01-12-2012 08:42 AM
Me-DIP-seq troubleshooting, several questions NearyJL78 Illumina/Solexa 7 09-27-2011 08:24 AM
Directional RNAseq troubleshooting deepakpatilp Illumina/Solexa 3 12-03-2010 12:28 PM
illumina library prep troubleshooting guide? seqgirl123 Sample Prep / Library Generation 4 01-18-2010 02:12 PM
Troubleshooting routines runemoe Illumina/Solexa 0 01-13-2010 05:09 AM

Reply
 
Thread Tools
Old 03-04-2011, 08:06 AM   #1
biochembug
Member
 
Location: New York

Join Date: Mar 2011
Posts: 26
Default troubleshooting illumina seq

Dear friends

I have my library which is prepared using custom made primers published in a an article. My eventual product (double stranded of course) will look like this:


5'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT(Insert)GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT3'

Though I had a run but the data quality from Illumina sequencer (Illumina Genome Analyzer II (GAIIx) was not good. The number of cluster formation was less compared to other samples on the same chip (run along with 7 other samples). I would like to know whether my final library product (sequence above) will hybridize properly with the oligos on the chip? Please suggest.

Biochembug
biochembug is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:09 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO