Dear HiSeqers
Can anyone confirm the sequence of the SE v3 sequencing primer. Best I can find is 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3', but unsure if that is for V2 or V3 sequencing kits...or if it even has changed.
Scott
Can anyone confirm the sequence of the SE v3 sequencing primer. Best I can find is 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3', but unsure if that is for V2 or V3 sequencing kits...or if it even has changed.
Scott
Comment