
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Bfast color space tag and GATK error adamhfreedman Bioinformatics 5 08-21-2012 08:28 AM
SRMA error Ori Bioinformatics 6 08-19-2011 08:09 AM
another question about SRMA rlh Bioinformatics 2 10-23-2010 11:51 PM
SRMA Error dmurdock Bioinformatics 14 10-21-2010 06:02 PM
srma-0.1.8 error - Cannot check readability of null file. allenday Bioinformatics 1 10-12-2010 12:30 AM

Thread Tools
Old 06-17-2011, 03:32 AM   #1
Junior Member
Location: Nottingham

Join Date: Oct 2010
Posts: 9
Default SRMA - Error - cs TAG


First time using SRMA, followed the user guide on source forge. Left all variables as defaults. It came up with this error. Any suggestions as to what I need to do to fix this?

chris@deepseq:~/DeepSeq/SRMA$ java -jar srma-0.1.15.jar I=1.3_case_sort2_head.bam O=srma_1.3_case.bam R=valid_4.fa CORRECT_BASES=FALSE
Allele coverage cutoffs:
coverage: 1 minimum allele coverage: 0
coverage: 2 minimum allele coverage: 0
coverage: 3 minimum allele coverage: 0
coverage: 4 minimum allele coverage: 1
coverage: 5 minimum allele coverage: 1
coverage: 6 minimum allele coverage: 1
coverage: 7 minimum allele coverage: 2
coverage: 8 minimum allele coverage: 2
coverage: 9 minimum allele coverage: 3
coverage: >9 minimum allele coverage: 3
java.lang.Exception: Error. The current alignment's read bases length does not match the length of the colors in the CS tag.
at srma.Align.align(
at srma.SRMA$
mrxcm3 is offline   Reply With Quote
Old 06-17-2011, 10:22 AM   #2
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

It looks like your SAM file is malformed. Can you make sure that the following assertion is true as indicated by the error message: "The current alignment's read bases length does not match the length of the colors in the CS tag."? You can also print a few SAM records here so we can take a look.
nilshomer is offline   Reply With Quote
Old 06-20-2011, 04:41 AM   #3
Junior Member
Location: Nottingham

Join Date: Oct 2010
Posts: 9
Default Srma


Thanks for the reply - I figured this may the case. Here is the SAM. Thanks for taking a look.

@HD VN:1.0 GO:none SO:coordinate
@SQ SN:4 LN:191154276 UR:file:/data/results/Morgan/human_amplicon_F3_genome_bioscope1.3/genome/Homo_sapiens.GRCh37.59.dna.toplevel.chr_only.valid.fa
@RG ID:20101201200842917 PL:SOLiD LB:lib1-50F PI:0 DT:2010-12-01T12:08:42-0800 SM:case CN:freetext
@PG ID:MaToBam VN:1.12
100_905_888 0 4 88451319 100 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIII:III7@IIIEFIH@38G426CIII5BIIB;:2 RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:ABBABAA@9ABBA?@@@<.-=@3%<;>9-:;.3D80%.);7>.(;<03)2 CS:Z:T03322021101120202301233121003002130210333330102222
101_846_1575 0 4 88451319 86 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACGGGTTATATAACCTCTC IIIIIIIIIIIIIIIIII9;II<@III?DII9)66%;IIIII=IIG52*% RG:Z:20101201200842917 NH:i:1 CM:i:3 CQ:Z:BB?BBA<B2AA9=>A7@75%7A<D@;>-32<1)D6D%75<;<.0;?)-&% CS:Z:T03322021101120202301233021003002130010333330102222
102_1531_973 0 4 88451319 100 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIE@III;5IIIGEIII<2;3=@FIII3CIII@E: RG:Z:20101201200842917 NH:i:1 CM:i:1 CQ:Z:>BB@B??@A>ABA@A;@42/?@;D5?><,:7=8%..&8)>9>-'=:95,: CS:Z:T03322021101120202301233221003002110210333330102222
102_681_1033 0 4 88451319 97 50M * 0 0 TATCTTCACCACTTCCTAACTATGACCCGGGACAAGTTATATAACCTCTC IIIIIIIIIIIIIIIIIIBIII=9IIIBGIII%%>3&&4FIA7IIII@7- RG:Z:20101201200842917 NH:i:1 CM:i:2 CQ:Z:BBBBBA@@<A@AA<?7@86->=5)1=;7,<?=2%1.&'&/89)/=976+- CS:Z:T03322021101120202301233121003002100211333330102222
mrxcm3 is offline   Reply With Quote
Old 06-20-2011, 10:12 AM   #4
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

Those lines look fine, so it may be a problem later in the file. I have just committed code to the git repository to output the read name for that specific error. Can you install the version from the git repository and then identify the specific read?
nilshomer is offline   Reply With Quote

colorspace, srma

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:51 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO