SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Reply
 
Thread Tools
Old 09-17-2014, 10:04 PM   #21
weigrc
Member
 
Location: Hong Kong

Join Date: Oct 2011
Posts: 45
Default

Quote:
Originally Posted by dalin View Post
thanks for your reply, which explained a lot. Yes I am using amplicon. The worse is that my library has only about 20bp diverse sequence in 5 and 3 end. the sequence in between is a linker, means there is no diverse at all. i cannot change my library. but hope there will be a trick to circle this problem.

After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

As nucacidhunter said, you may give more info for trouble shoot, like listed below:

(1) What/which protocol/kit for library construction?
(2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
(3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
(4) % of PhiX spike-in?
weigrc is offline   Reply With Quote
Old 09-17-2014, 10:16 PM   #22
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.
Brian Bushnell is offline   Reply With Quote
Old 09-18-2014, 12:06 AM   #23
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by Brian Bushnell View Post
I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.
Thanks for reply, In this library,i only PCR amplification for about 19 cycles......
dalin is offline   Reply With Quote
Old 09-18-2014, 12:11 AM   #24
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by weigrc View Post
After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

As nucacidhunter said, you may give more info for trouble shoot, like listed below:

(1) What/which protocol/kit for library construction?
(2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
(3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
(4) % of PhiX spike-in?
in this library,i use the custom sequencing primers
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

With the custom sequencing primers, the library sequence is
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--NNNNNNNNNNNNNNNNNNNN------GTCGGAGAATTCCTTACTAGTAGAACTCTGTTCTTGAGCTAGCATCGATGCTAGCTCAAGAACAGAGTTCTACTAGTAAGGAATTCTCCGAC----NNNNNNNNNNNNNNNNNNNN---GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
thanks a lot!
dalin is offline   Reply With Quote
Old 09-18-2014, 04:49 AM   #25
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,230
Default

From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.
nucacidhunter is offline   Reply With Quote
Old 09-18-2014, 11:12 PM   #26
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by nucacidhunter View Post
From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.
Thank you very much,the 5 and 3 flanking divergent sequence are accually 19-21 bp(probally mainly 20),we used hiseq 2000. other lines in this run looks fine. so it may not likely caused by reagent.
you suggest help me a lot, thank you!
dalin is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:08 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO