How to get the expression level of specific gene without annotation in RNA-Seq?

[super0925]

I have one samples in fastq files from bovine (bovine_sample1.fastq). If I want to see whether a sequence (supposed named "GQ2") is expressed in bovine cells. (I have got the FASTA of this sequence) The sequence is unannotated in the current bovine genome, so might not have been tested in the analyses thus far.
As we know , in RNA-Seq, the expression level is number of raw reads counts mapped to genome.so my solution is like this:

My solution (2 steps):
(1) generate the bowtie2 index of GQ2.

>GQ2
ATGGAGCACTTTCCCCGCTGTGTGCACGAGTCCTGGGGTTCCTCAAAGGA
GCCCCAGAAAACAGAGGTGCTGCAACTCTTGAGCTTAGCGGACCCTGAGG
.....
mkdir GQ2Bowtie2Index
cd GQ2Bowtie2Index
bowtie2 GQ2.fa GQ2
ls
GQ2.1.bt2 GQ2.2.bt2 GQ2.3.bt2 GQ2.4.bt2 GQ2.fa GQ2.rev.1.bt2 GQ2.rev.2.bt2

(2) map the reads file on to 'GQ2' genome

bowtie2 --local --very-sensitive-local -p 8 -x ./GQ2Bowtie2Index/GQ2 -U bovine_sample1.fastq

But when I did it, I got the error.
After I ran the bowtie2, it goes to the endless loop (obviously it is error). If I terminate the bowtie2, I found the error.
"bowtie2-align died with signal 2 (INT)"

Could you please tell me:

1. Is my solution correct? If it is not, do you have any solution?
2. If mine is correct, why did I get the error? Do my command lines have the problem? ?