SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
ReorderSam.jar in picard and GATK wisekh Bioinformatics 0 12-12-2011 07:27 AM
Estimatelibrarycomplexity.jar in Picard Jin Pan Bioinformatics 0 12-02-2011 06:46 AM
GATK: GenomeAnalysisTK.jar file jorge Bioinformatics 2 06-05-2011 08:59 PM
Myrna new reference jar middlemale RNA Sequencing 2 01-10-2011 02:39 PM
BowtieToBedFormat.jar from Vancouver Short Read Analysis Package DrD2009 Bioinformatics 2 12-14-2009 07:39 AM

Reply
 
Thread Tools
Old 01-19-2011, 09:45 AM   #1
doc2r
Junior Member
 
Location: Huntington

Join Date: Aug 2010
Posts: 9
Default CollectGcBiasMetrics.jar

Hi there,

When I run PICARDs CollectGcBiasMetrics.jar I get the following error message



Exception in thread "main" net.sf.samtools.SAMException: Exception counting mismatches for read XXXXXX_0164:6:6:3247:26441#0 1/2 100b aligned read.
at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:251)
at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:204)
at net.sf.picard.analysis.CollectGcBiasMetrics.doWork(CollectGcBiasMetrics.java:15
2)
at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:156)
at net.sf.picard.analysis.CollectGcBiasMetrics.main(CollectGcBiasMetrics.java:94)
Caused by: java.lang.ArrayIndexOutOfBoundsException: 135374737
at net.sf.samtools.util.SequenceUtil.countMismatches(SequenceUtil.java:237)
... 4 more


I know the read XXXXXX_0164:6:6:3247:26441#0 1/2 maps to the telomeres and one maps off the end (this error I was able to "SILENT")but I really can't see what the problem. Any advice... Sequences are below





XXXXXX_0164:6:6:3247:26441#0 163 chr10 135374442 23 21M1I26M52S = 135374638 297

TTAGGGGTTAGGGTTGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGAGGGGTGGGGGGAGGGGTGTGGGGTGGGTGTGGGTGGGGGTGGG

HHHHHFHAEAEEE?EGEE5B@DGDDCD?GGE7B5E<=4@<<@1<6C#####################################################
XC:i:48 XT:A:U NM:i:1 SM:i:23 AM:i:23 X0:i:1 X1:i:1 XM:i:0 XO:i:1 XG:i:1 MD:Z:47


XXXXXX_0164:6:6:3247:26441#0 83 chr10 135374638 23 1S47M1D4M1D48M = 135374442 -297
TAGGGTTGGGGTGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTAGGGTAGGGTTAGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGT

##@?@@*@?DC/ACEDE>DBCB7ABEEF@E6FFDBG8GGFFFFFFEF@GEFGGGGGGFFFF@GFEFEFGGGGGFGGGGGGGGGGGGGEGGGFGGGGB

XC:i:99 XT:A:M NM:i:13 SM:i:23 AM:i:23 XM:i:11 XO:i:2 XG:i:2 MD:Z:5G0A16G23^G4^T12G0A5A5A4G0A5A5A4
doc2r is offline   Reply With Quote
Old 10-23-2013, 08:06 AM   #2
rpauly
Member
 
Location: Atlanta

Join Date: Apr 2011
Posts: 32
Default

Did you find a solution to this? I am having the same problem...
Exception in thread "main" net.sf.samtools.SAMException: Exception counting mismatches for read HWI-ST1392:125:C1HB2ACXX:5:2209:1874:47375 1/2 100b aligned read
rpauly is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:35 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO