SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BLAST Database error: No alias or index file found for nucleotide database [nt] chris_s Bioinformatics 14 03-24-2019 07:11 AM
malloc error on OS X 10.11 (El Capitan) with Fastx_collapser adisaxena Bioinformatics 6 10-24-2015 05:08 AM
why the read sequence from IGV can't be found in fastq? hujiacun Bioinformatics 2 04-17-2015 09:24 AM
Doing local blast. No alias or index file found for nucleotide database? hyates Bioinformatics 2 03-09-2015 04:22 AM
Fastx Trimmer : invalid sequence Oliviervg Bioinformatics 0 03-09-2012 12:56 AM

Reply
 
Thread Tools
Old 03-13-2017, 06:58 AM   #1
Palgrave
Member
 
Location: norway

Join Date: Aug 2011
Posts: 73
Default fastx_collapser: found invalid nucleotide sequence

Anyone know what the reason is?

fastx_collapser: found invalid nucleotide sequence (TCTTAACCCGGACCAGAAACTA ) on line 2




>1-1460323
TCTTAACCCGGACCAGAAACTA
>2-1321361
AGGTTCCGGATAAGTAAGAGCC
>5-342436
TAGCATATCGAGCCTGAGAACA
>6-267424
TGATACGGATGTTATACGCAGC
>7-221604
CGGTTCCGGATAAGTAAGAGCC
Palgrave is offline   Reply With Quote
Old 03-13-2017, 07:09 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,046
Default

Not answering your question but wanted to suggest that you may want to try clumpify.sh from BBMap for this purpose (http://seqanswers.com/forums/showpos...3&postcount=29). See full thread for additional information.
GenoMax is offline   Reply With Quote
Old 03-13-2017, 10:36 AM   #3
gringer
David Eccles (gringer)
 
Location: Wellington, New Zealand

Join Date: May 2011
Posts: 838
Default

It could be the space at the end of the line. I notice that there is no space after the opening bracket, and one space before the closing bracket.
gringer is offline   Reply With Quote
Old 03-13-2017, 10:52 AM   #4
Palgrave
Member
 
Location: norway

Join Date: Aug 2011
Posts: 73
Default

I think so. Any idea how to remove it?
Palgrave is offline   Reply With Quote
Old 03-13-2017, 10:53 AM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,046
Default

Code:
sed 's/\ $//g' your_file > new_file
should do it.
GenoMax is offline   Reply With Quote
Old 03-13-2017, 11:08 AM   #6
Palgrave
Member
 
Location: norway

Join Date: Aug 2011
Posts: 73
Default

Thanks. It worked
Palgrave is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:40 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO