We want to index by ourselves, since we want to pool several 96 well plate thing together. I looked up in the illumina protocol it was written
Nextera® Index Kit - PCR primers
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
(c) i5 Index read -->
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
<-- i7 Index read (b)Nextera® Index Kit - PCR primers
for the i5 and i7 part are there any length restrictions. I saw some said 8 bps, but in others'paper, I saw from 5 bp to 10 bp. I just wondered what is the rule to fill into this i5 and i7 part.
In addition, can any sequence be filled into these part (of course different sequences) or there have any rules for it.
Thanks a lot
Nextera® Index Kit - PCR primers
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
(c) i5 Index read -->
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
<-- i7 Index read (b)Nextera® Index Kit - PCR primers
for the i5 and i7 part are there any length restrictions. I saw some said 8 bps, but in others'paper, I saw from 5 bp to 10 bp. I just wondered what is the rule to fill into this i5 and i7 part.
In addition, can any sequence be filled into these part (of course different sequences) or there have any rules for it.
Thanks a lot
Comment