SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Can or should we perform feature counting with `bedtools intersect -c`? foolishbrat Bioinformatics 1 09-01-2017 07:11 AM
bedtools intersect -f -F -r behavior pepeluisrr Bioinformatics 0 08-15-2017 07:07 AM
intersect file bam-bed and count read edeka Bioinformatics 3 06-20-2016 02:34 AM
BEDtools intersect output is BED instead of BAM syfo Bioinformatics 1 12-18-2012 04:26 AM
GATK: unable to write data to BAM schedule file bjchen Bioinformatics 5 02-13-2012 12:21 AM

Reply
 
Thread Tools
Old 05-04-2018, 10:06 AM   #1
cursecatcher
Junior Member
 
Location: Italy

Join Date: May 2018
Posts: 5
Unhappy Unable to intersect BAM file with bedtools

Hi everyone, I'm trying to use bedtools intersect to check the number of mapped reads in target regions (in a .bed file) originated by targeted bisulfite sequencing experiment (EpiSeq Roche).

I used the following command.

Code:
./bedtools intersect -bed -abam sample2.bam -b 
 ~/Data/MethylSeq/dataset/Agesmoke_dataset/AgeSmkSop_all_primary_targets.bed
The program terminate with the following message and no result at all.

Code:
* WARNING: File sample2.bam has inconsistent naming convention for record:
NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +

* WARNING: File sample2.bam has inconsistent naming convention for record:
NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +
I tried to modify the original SAM file removing the read that cause the problem (that was the first read in the SAM file) and the problem persists with the second read. I tried also the option -nonamecheck with no results.

Can someone help us? Thank you.
Nicola
cursecatcher is offline   Reply With Quote
Old 05-04-2018, 10:27 AM   #2
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 694
Default

Check your chromosome names.
Are they "chr" style in both bed and bam?
Richard Finney is offline   Reply With Quote
Old 05-04-2018, 11:26 AM   #3
cursecatcher
Junior Member
 
Location: Italy

Join Date: May 2018
Posts: 5
Default

Quote:
Originally Posted by Richard Finney View Post
Check your chromosome names.
Are they "chr" style in both bed and bam?
Hi Richard, thanks for the reply.
About your question, I think not.

In the bed file I have record like this:
Code:
chr1    11123000        11123242        chr1:11123018-11123218
chr1    16696418        16696674        chr1:16696447-16696647
while in the SAM file (and consequently in the BAM file) I have record like that:

Code:
M03971:33:000000000-BN5NL:1:2114:12003:16132    99      NC_000016.9     24163387        255     151M    =       24163431        194     TGATCGGTGGTGA
TGGGTTAGGTAGAGTGTATTAGTTCGTTTTTATGTTGTTGATAAAGATATATTCGAGATTGTGTAATTTATGAAAAAGAGGTTTAATGGATTTGGGGAGGTTTTAATTATGGTGGAAGGTTAAAGTTATGTTTTATAT BCCCCCCBBC
ABGGGGGGFGGGGHHHHFGGHHHHHHHHGGHGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHFHHHHGGHHHHHHHHHHHHHHHHGGFGGEHHGHHHHHHHHHHGHHHGHHHHHHHHHHHHHHHHHHH NM:i:1
  ZS:Z:++
Ps. the SAM file is the result of an alignment with BSMAP.

Is this the problem? How can I resolve it?
Nicola
cursecatcher is offline   Reply With Quote
Old 05-04-2018, 11:48 AM   #4
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 694
Default

NC_000016 is a name used for "chr16".
This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

You have to convert the "NCBI name" to "chr" names (or vice versa).

There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

Any easy way would be to reheader the bam file. Please see samtools documentation for this.
Richard Finney is offline   Reply With Quote
Old 05-04-2018, 01:20 PM   #5
cursecatcher
Junior Member
 
Location: Italy

Join Date: May 2018
Posts: 5
Default

Quote:
Originally Posted by Richard Finney View Post
NC_000016 is a name used for "chr16".
This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

You have to convert the "NCBI name" to "chr" names (or vice versa).

There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

Any easy way would be to reheader the bam file. Please see samtools documentation for this.
It works, thank you so much!!
I'm sorry for the triviality of the problem, but I'm not very practical with this stuff and the bedtools message wasn't very helpful.
Again, thank you!

Best regards
Nicola
cursecatcher is offline   Reply With Quote
Reply

Tags
bedtools

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:41 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO