Tweet
I'm using stand-alone BLAST to align transcripts I've assembled of a non-model species to the drosophila transcriptome. I want my output to be a CSV file that includes the actual NAME of the gene. Those names are listed in the standard blast output, but I can't figure out what switch to use to get it into the CSV.
The best I can do right now is get a sequence id- something like FBtr072340098, which I can search default blast output for and find the names manually...
My command line looks something like:
blastn -query sep-final.fasta -db dmel.fasta -out sepxdmel.csv -outfmt '10 qseqid sseqid qseq evalue length'
What I really want is a CSV that has something like:
NAME=abd-b,comp11522_c0_seq1,FBtr072340098,length=750,evalue=1e-51,ACGAATCTCTTGCTTACCGCTTCGCAAACCCCTACGAC
Which will make it easy for my labmates who don't do this kind of computer work to have an easy file they can search for a gene name to find a sequence to make primers and probes.
Any advice?
The best I can do right now is get a sequence id- something like FBtr072340098, which I can search default blast output for and find the names manually...
My command line looks something like:
blastn -query sep-final.fasta -db dmel.fasta -out sepxdmel.csv -outfmt '10 qseqid sseqid qseq evalue length'
What I really want is a CSV that has something like:
NAME=abd-b,comp11522_c0_seq1,FBtr072340098,length=750,evalue=1e-51,ACGAATCTCTTGCTTACCGCTTCGCAAACCCCTACGAC
Which will make it easy for my labmates who don't do this kind of computer work to have an easy file they can search for a gene name to find a sequence to make primers and probes.
Any advice?