
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Twin peaks, double peaks, double humps of RNA Seq, itís all very frustrating...HELP! AndyG Sample Prep / Library Generation 18 10-24-2015 03:43 PM
Duplicate peaks in MACS2 narrowPeak output barkasn Bioinformatics 2 05-06-2015 12:51 PM
low intensity signal with peaks under peaks mohd2b Sanger/Dye Terminator 5 11-19-2014 07:11 PM
Double peaks for BOTH forward and reverse tags in macs2 model of Chip-seq data - shal feralBiologist Bioinformatics 0 01-14-2014 02:09 PM
Comparing input peaks to IP peaks biznatch Epigenetics 2 09-24-2011 11:38 AM

Thread Tools
Old 06-16-2016, 05:48 AM   #1
Junior Member
Location: Manchester

Join Date: May 2016
Posts: 6
Default Too few peaks in MACS2

Hi everyone, I'm trying to call peaks with macs2 but run into the next warning when doing so:

"WARNING @ Tue, 14 Jun 2016 20:52:53: Too few paired peaks (0) so I can not build the model! Broader your MFOLD range parameter may erase this error. If it still can't build the model, we suggest to use --nomodel and --extsize 147 or other fixed number instead.
WARNING @ Tue, 14 Jun 2016 20:52:53: Process for pairing-model is terminated! "

I am working with treatment and control samples, the number of reads for each is: 18448586 for control and 26581254 for treatment. All the reads are mapped and uniquely paired, as I already filtered them.

Could anyone explain the cause for the warning? I've tried to find information but haven't find many...Is the error related to the difference in number of reads? I thought macs scaled the samples automatically.

Thanks in advance!

Update: So I'm guessing this is the reason:
"DEBUG @ Thu, 16 Jun 2016 16:00:24: Number of unique tags on + strand: 627266
DEBUG @ Thu, 16 Jun 2016 16:00:24: Number of peaks in + strand: 19221
DEBUG @ Thu, 16 Jun 2016 16:00:24: Number of unique tags on - strand: 0
DEBUG @ Thu, 16 Jun 2016 16:00:24: Number of peaks in - strand: 0
DEBUG @ Thu, 16 Jun 2016 16:00:24: Chrom chr16 is discarded!"

And it happens for all the chromosomes. Any ideas on how to fix it?

Last edited by tamadp; 06-16-2016 at 07:11 AM. Reason: update info
tamadp is offline   Reply With Quote
Old 06-16-2016, 10:05 AM   #2
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479

Can you post the first 10 or so alignments? Ideally you'll have a few with each orientation.
dpryan is offline   Reply With Quote
Old 06-16-2016, 10:30 AM   #3
Junior Member
Location: Manchester

Join Date: May 2016
Posts: 6

Originally Posted by dpryan View Post
Can you post the first 10 or so alignments? Ideally you'll have a few with each orientation.
Thanks for the reply, here it is:
D3YGT8Q1:296:C7M2RACXX:6:1105:5592:14554        99      chr1    9997    6       58M1I42M        =       10082   172     CCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
B<BBB   AS:i:-12        XS:i:-11        XN:i:4  XM:i:4  XO:i:1  XG:i:1  NM:i:5  MD:Z:0N0N0N0N96 YS:i:-18        YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1205:20071:45553       99      chr1    9997    6       67M1I19M        =       10371   463     CCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
        XN:i:4  XM:i:4  XO:i:1  XG:i:1  NM:i:5  MD:Z:0N0N0N0N82 YS:i:-21        YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1211:19409:52344       99      chr1    9997    6       101M    =       10040   141     CCCCTACCCCTACCCCTACCCCTAACCCTAACCCTAACCCTAACCCTA
AS:i:-20        XS:i:-21        XN:i:4  XM:i:7  XO:i:0  XG:i:0  NM:i:7  MD:Z:0N0N0N0N2A5A5A82   YS:i:-5 YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1107:16167:27127       99      chr1    10002   1       70M     =       10038   106     AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
YS:i:0  YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1204:15589:43336       99      chr1    10002   1       94M     =       10020   112     AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:94 YS:i:0  YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1301:20602:31346       99      chr1    10003   0       5M1D43M1I6M1I24M1I8M    =       10065   129     ACCCTACCCTAACCCTAACCCTAACCCTAACC
AS:i:-35        XS:i:-30        XN:i:0  XM:i:1  XO:i:4  XG:i:4  NM:i:5  MD:Z:5^A54A26   YS:i:-4 YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1313:3132:51176        99      chr1    10003   1       34M1I60M        =       10351   384     ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTTAACC
        XS:i:-6 XN:i:0  XM:i:2  XO:i:1  XG:i:1  NM:i:3  MD:Z:53A11A28   YS:i:-2 YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:2103:13849:36280       99      chr1    10003   0       47M3I22M        =       10016   106     ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCCACCCTACCCTGACCCTGACCCTGACC        BBBFFFFFFFFFFIIIIIIIIIFIIIIIFIFIIIB7BFFIF77BB''7<<''7BBB'7BFFB'7BF<0'7<B        AS:i:-28        XS:i:-21        XN:i:0  XM:i:6  XO:i:1  XG:i:3  NM:i:9  MD:Z:42A3T0A5A5A5A3     YS:i:-24        YT:Z:CP
D3YGT8Q1:296:C7M2RACXX:6:1107:9298:15688        99      chr1    10004   1       39M     =       10398   433     CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC BBBFFFFFFFFFFIIIFIFFIIIFFIIFFFFFFIBFFFI AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:39 YS:i:0  YT:Z:CP
tamadp is offline   Reply With Quote
Old 06-17-2016, 05:00 AM   #4
Junior Member
Location: Manchester

Join Date: May 2016
Posts: 6

So, I didn't realise the format needed to be specified for paired ends and I managed to make it work by running the "-f BAMPE" command. However, macs is still not building the R model, any reason why?
tamadp is offline   Reply With Quote

macs2, peak calling, warning message

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:18 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO