SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Adapter/primer trimming from RNAseq reads everestial General 44 03-05-2015 11:08 AM
Trimming adapter sequence in the middle of a read milesgr Bioinformatics 7 12-15-2013 12:39 PM
Adapter sequence trimming cew85911 Bioinformatics 2 11-19-2013 02:53 AM
Adapter trimming and trimming by quality question alisrpp Bioinformatics 5 04-08-2013 04:55 PM
Single cell RNAseq _ Transcriptome sequence honey Bioinformatics 5 08-21-2012 09:43 AM

Reply
 
Thread Tools
Old 03-20-2015, 08:23 AM   #1
cefanter
Junior Member
 
Location: St. Louis, Missouri, USA

Join Date: Mar 2015
Posts: 2
Default Appropriate Adapter Sequence fora trimming? RNAseq Transcriptome

For previous studies I have contracted out both Illumina sequencing and RNAseq analysis of transcriptomes. An updated reference genome was added to NCBI this past year, and I want to take previously sequenced fastq files and realign them to the new reference genome in galaxy using Tophat and Cufflinks. I contacted the sequencing facilities to understand their protocol to determine if adapter sequences had been removed. They were unclear whether or not the trimming had already been executed, and their response time to my questions is lagging. They have however sent me this email.

"We performed a polyA selection with a kit from Ambion: MicroPoly(A) Purist Kit; required 1000ng as starting material

We used a cDNA kit from NuGEN: Ovation RNA-Seq System V2; we added 1ng of mRNA into the reaction. There is a SPIA adaptor sequence you will most likely want to trim off the 5' ends.
We used an in house cocktail for the Illumina libraries (combination of kits from Lucigen and NEB); we initiated the Illumina libraries with 500ng of cDNA. We used the indexed Illumina adaptors:

Multiplexing Adapters
5' P-GATCGGAAGAGCACACGTCT
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Multiplexing PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

Multiplexing PCR Primer 2.0
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

PCR Primer, Index 1
5 CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC

Let me know if you have more questions.

Thanks!
Catrina


Index Sequence - XXXXXX
Sample Library
GCCGCG CPAM-RS15-RS15-V1 CPAM-RS15-RS15-V1-cDNA-1-lib1a
GCTCCA CPAM-RS14-RS14-CS1 CPAM-RS14-RS14-CS1-cDNA-1-lib1a
GGCACA CPAM-RS9-RS9-CS1 CPAM-RS9-RS9-CS1-cDNA-1-lib1a
GGCCTG CPAM-RS12-RS12-V1 CPAM-RS12-RS12-V1-cDNA-1-lib1a
GTCCGC CPAM-RS11-RS11-CS1 CPAM-RS11-RS11-CS1-cDNA-1-lib1a
TAATCG CPAM-RS11-RS11-V1 CPAM-RS11-RS11-V1-cDNA-1-lib1a
TACAGC CPAM-RS16-RS16-V1 CPAM-RS16-RS16-V1-cDNA-1-lib1a
TATAAT CPAM-RS13-RS13-CS1 CPAM-RS13-RS13-CS1-cDNA-1-lib1a
Index Sequence - XXXXXX Sample Library
CACCGG CPAM-RS12-RS12-CS1 CPAM-RS12-RS12-CS1-cDNA-2-lib2a
CCTTAG CPAM-RS9-RS9-V1 CPAM-RS9-RS9-V1-cDNA-2-lib2a
CTCAGA CPAM-RS8-RS8-CS1 CPAM-RS8-RS8-CS1-cDNA-2-lib2a
CTGCTG CPAM-RS8-RS8-V1 CPAM-RS8-RS8-V1-cDNA-2-lib2a
GACGGA CPAM-RS13-RS13-V1 CPAM-RS13-RS13-V1-cDNA-2-lib1a
GATATA CPAM-RS14-RS14-V1 CPAM-RS14-RS14-V1-cDNA-2-lib1a
GATGCT CPAM-RS15-RS15-CS1 CPAM-RS15-RS15-CS1-cDNA-2-lib1a
GTAGAG CPAM-RS16-RS16-CS1 CPAM-RS16-RS16-CS1-cDNA-2-lib1a "

I want to make sure that there is no contamination of adapter sequences, even though the quality of my reads is high. I have tried creating a fasta file using the Multiplexing Adapters sequences listed above, and attempting trimming using Scythe, however the output file always is empty. Am I using the correct sequences? Do I need to trim individual fastq files using their appropriate indexes? I am still new to the process, so any advice would be appreciated.
cefanter is offline   Reply With Quote
Old 03-20-2015, 09:35 AM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I recommend creating a fasta file with all the sequences, except for the one with XXXXXX, make a copy of that with each index - GCCGCG, GCTCCA, etc. Then trim all of your reads with the same fasta file. Sometimes there is confusion about which orientation the adapters will be read in, so it may also be useful to try the reverse-complements as well if scythe doesn't do that automatically.

If the reads have never been trimmed in any way, they will all be the same length.
Brian Bushnell is offline   Reply With Quote
Old 03-25-2015, 10:27 AM   #3
cefanter
Junior Member
 
Location: St. Louis, Missouri, USA

Join Date: Mar 2015
Posts: 2
Default

Brian,

Thanks for the advice.

I am still having problems with trimming using the tool scythe in a local host galaxy. I went ahead and created a fasta file containing all of the adapters and their reverse sequences. The resulting output has a description of "no peek" and is empty. The fasta file is in the proper format with each adapter identification line starting with a ">" and a following line of sequence containing only basepair letters (see attached).

Is this an internal problem with scythe downloaded to galaxy? would another tool be more appropriate for my need of trimming out adapters? What causes this no peek result?
Attached Images
File Type: png nopeek.png (12.1 KB, 5 views)
Attached Files
File Type: txt Multiplexing Adapters.txt (3.4 KB, 30 views)
cefanter is offline   Reply With Quote
Old 03-25-2015, 10:43 AM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Your adapter file appears to be valid. Unfortunately, I don't use Galaxy or Scythe, so I'm not sure what the problem might be, or what "no peek" is supposed to mean. If you are able to process your data on the command line, I suggest you try running BBDuk, like this:

bbduk.sh in=reads.fastq out=trimmed.fastq ref=adapters.txt ktrim=r k=23 mink=11 hdist=1
Brian Bushnell is offline   Reply With Quote
Old 03-25-2015, 10:46 AM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,953
Default

I don't have access to a galaxy with scythe installed but I think this may be a problem with your local galaxy. Have you asked your local galaxy admins/support for help?

There are many tools that can trim but you will need to work outside galaxy.
GenoMax is offline   Reply With Quote
Reply

Tags
adapter trimming, galaxy; bio-linux, illumina, rnaseq alignment, transcriptomes

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:15 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO