
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
BBduk for NexteraXT arivers Bioinformatics 3 05-07-2018 10:52 AM
Extract 'amplicon' based on custom primers SDH Bioinformatics 3 05-07-2018 08:57 AM
BBDUK and BBMERGE, which goes first chloe1005 Bioinformatics 1 04-12-2018 03:43 AM barcode filter lamon Bioinformatics 8 11-18-2017 03:51 AM
Trimmomatic vs mslider Bioinformatics 1 04-18-2017 10:10 AM

Thread Tools
Old 01-31-2019, 03:28 AM   #1
Junior Member
Location: Turkey

Join Date: Jan 2019
Posts: 3
Default Extract Seq from Primers on BBDuK

Hello guys, a newbie in here.

I have reads from nanopore, converted fast5 files into fastq, what i am trying to do is extract the sequences between the primers. I attempt to do it by bbduk from BBMap.

First I tried this

./ in=/home/celik/Downloads/deneme/2/first0.fastq out=/home/dnacoder/Downloads/deneme/2/cikis.fasta literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
which gave me an error saying "Error: Could not find or load main class jgi.BBDukF"

Then I searched and tried this running this code

java -ea -Xmx1g -cp /home/celik/Downloads/BBMAP/BBMap-master/sh/current/jgi.BBDuKF in=first0.fastq out=cikis.fastq literal=AGAGTTTGATCCTGGCTCAG,CTACGGCTACCTTGTTACGA
then it gave me an error that read "Could not find or load main class in=first0.fastq"

Can anyone tell me what am I doing wrong, i ve looked on google and tried couple of things such as "export CLASSPATH=$CLASSPATH:." but did not make any change.

Thanks in advance.
m.a.celik is offline   Reply With Quote
Old 01-31-2019, 05:34 AM   #2
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,092

Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?
GenoMax is offline   Reply With Quote
Old 01-31-2019, 05:40 AM   #3
Junior Member
Location: Turkey

Join Date: Jan 2019
Posts: 3

Originally Posted by GenoMax View Post
Are you doing this on windows? You have not moved any of the contents of BBMap software folder after you downloaded it?
Nope, I am on biolinux(Ubuntu), and no I ve just extracted the zip file, didn't move anything. Thanks for a quick respond.
m.a.celik is offline   Reply With Quote
Old 05-16-2019, 07:39 AM   #4
Junior Member
Location: Turkey

Join Date: Jan 2019
Posts: 3

Guys anyone can help me? I am still struggling with this.
m.a.celik is offline   Reply With Quote

bbduk, bbmap, filter by primers

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 07:33 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO