SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
sam to bam conversion error, no @SQ lines in the header, missing header? efoss Bioinformatics 17 12-03-2015 04:28 AM
bowtie2 output, sam to bam conversion error. a_mt Bioinformatics 3 03-29-2015 01:23 AM
samtools: parse error in SAM to BAM conversion chrisW Bioinformatics 12 01-14-2013 06:16 PM
Issue with Sam-Bam conversion samtools - how to remove last line of Sam file? TabeaK Bioinformatics 3 11-19-2012 10:05 AM
Tophat v1.1.4 potential error with sam to bam conversion? jb2 Bioinformatics 6 11-17-2011 12:52 AM

Reply
 
Thread Tools
Old 12-10-2012, 04:56 AM   #1
DavyK
Junior Member
 
Location: Cardiff

Join Date: Jun 2012
Posts: 9
Default sam 2 bam conversion error

Hi all, Just aligned some exome sequencing data for an individual, and when converting from sam to bam I get this error:

samtools view -h -S -b -o 1001-1.bam 1001-1.sam
[samopen] SAM header is present: 84 sequences.
Parse error at line 90: sequence and quality are inconsistent
Abort trap: 6

I looked at line 90 in the sam file:

B02V0ACXX110721:1:1207:10678:69422 141 * 0 0 * * 0 0 GGTTAGGGTTAGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTAGGGGGTTAGGGTTAG !!#'%'%''%%)(*(
$$'&)"$()**&''#")&% %(&

I noticed there were no alignment coordinates. I checked for a bunch of entries in the samfile within the first 1000 lines. There were no alignment coordinates for any of them. Could it be something to do with my reference? I know this data is good as it has been aligned and analysed by others before me. I have been having trouble aligning other data also. Only thing in common is software and reference (reference downloaded from GATK resource bundle, indexed with bwa index).

Any suggestions are welcome.

Cheers,
Davy
DavyK is offline   Reply With Quote
Old 12-10-2012, 05:51 AM   #2
valei
Member
 
Location: italy

Join Date: Sep 2010
Posts: 14
Default

generally the sequence length should be equal to the quality string length. In your read you have 76 nucleotides and only 38 character for the quality string....probably there are some problem with you input fastq.
valei is offline   Reply With Quote
Old 01-14-2013, 06:13 PM   #3
DNASpeaks
Junior Member
 
Location: USA

Join Date: Oct 2012
Posts: 5
Default

Hello Everyone,
I am having trouble converting the sam files to bam using samtools. I used this cmd to convert my sam to bam -

samtools view -bT hg19.fa s_chip2.sam > s_chip2.bam
I got this error.
Parse error at line 7707082: sequence and quality are inconsistent
Aborted


I ran ValidateSamFile.jar, a picard tool and got the following error, hundreds of them -

WARNING: Read name HWI-ST798R:82: D18MUACXX:2:1101:2025:1987, A record is missing a read group
ERROR: Record 5, Read name HWI-ST798R:82: D18MUACXX:2:1101:8625:1992, Empty sequence dictionary.

I am not sure how to fix this, any help is appreciated.
DNASpeaks is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:34 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO