Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Lots of "N" in the barcode.

    Dear All

    I am new to NGS and GAII.

    After several test running ,we have a big problem.

    We usually have 6 samples with different barcode(index 2,3,4,7,9,10) in one lane. We have 3.5G data totally in each lane, but the CASAVA only can demultiplexing 64M.

    Most of data under Undetermined_indices fold are like this.


    @=78@==<:=BDDDDGEGG?===B@>ACBAGGGG@DD==>EEE?EDGE3GEEC>>,838<E>>C???D?=6(/9?:?########################
    @ILLUMINA-8ACF53:7:FC:1:52:5835:9761 1:N:0:NNNNGN
    TAAACTTTATAATTAAAAAAAAATGCTCATTTGAGCTGCAATAGTTTTACTAACTTTTAATGTCTTAATTCAAATACCCAGTTTCCATAACATAATATCTA

    There lots of N in the barcode,so CASAVA cann't demultiplex samples.

    We have a little bit overclustering. %PF of my sample is only 29.5+/- 27.32. Is this the main reason?

    How to make troubleshooting with this?

    Thank you so much.

  • #2
    There is nothing you are going to be able to do when samples are over-clustered (~30% PF is a clear indication) and the tag read fails this way.

    You will have to re-run these samples at a lower density.

    Comment


    • #3
      Thank you so much.

      How to improve the %PF? Do you have some advises?

      Originally posted by GenoMax View Post
      There is nothing you are going to be able to do when samples are over-clustered (~30% PF is a clear indication) and the tag read fails this way.

      You will have to re-run these samples at a lower density.

      Comment


      • #4
        Originally posted by illuminaGA View Post
        Thank you so much.

        How to improve the %PF? Do you have some advises?
        This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

        As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

        You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.

        Comment


        • #5
          Thank you so much.

          I only got this problem in lane1 and lane2. And the every sample's concentration of lane1 is 8pM.

          The cluster Density is 1153+/-98,Cluster PF is 29.46+/- 27.44.

          This is the first time that I prepared the library by myself. And Lane1 is the TEST lane. The other lanes were good libraries.

          I measured the concentrations by Bioanalyzer since our Real-time PCR meachine was out of order. So I think the concentrations were not accurate.

          Thank you so much again.




          Originally posted by GenoMax View Post
          This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

          As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

          You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.
          Last edited by illuminaGA; 04-24-2013, 08:33 AM.

          Comment


          • #6
            Originally posted by GenoMax View Post
            This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

            As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

            You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.
            Hello GenoMax

            I sent all may SAV file to illumina techsupport ,after analyzed my data,they said that "HP8 did not hybridize with those IDT sample preps. The intensity readings of index 1 is nearly zero, which accounts for not seeing index counts in your results. Since the index 1 worked in the other lanes, it is likely not a index primer fluidics issue on the instrument. This would also confirm the effectiveness of the HP8 primer in the system."

            I used IDT Y shape TruSeq dup Adapter for my libraries preparation. The sequence of the adapter as follow.

            TruSeq Universal Adapter
            AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGA TC *T-3


            TruSeq Indexed Adapter
            GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACA-CGAGAAGGCTAG*P-5


            I ordered TruSeq SBS Kit v5 - GA (36-cycle)(FC-104-5001) for our GA IIx and TruSeq PE Cluster Kit v2(PE-300-2001) for cBot.

            Did I make mistake about my adapters?

            Thanks

            Comment


            • #7
              I don't think the adapters were the problem. As the others have said, you were way too overclustered in that lane. You can try upping the mismatch rate or playing with the failed reads to get some more data back, but the chances of getting even 50% of your data back are pretty slim.

              Next time you encounter overclustering in your flow cell, I would suggest immediately performing a strip and rehyb of your primers and restarting the run. This will usually lower the cluster density a little bit.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Essential Discoveries and Tools in Epitranscriptomics
                by seqadmin




                The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                04-22-2024, 07:01 AM
              • seqadmin
                Current Approaches to Protein Sequencing
                by seqadmin


                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                04-04-2024, 04:25 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, Today, 08:47 AM
              0 responses
              11 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-11-2024, 12:08 PM
              0 responses
              60 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 10:19 PM
              0 responses
              59 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 09:21 AM
              0 responses
              54 views
              0 likes
              Last Post seqadmin  
              Working...
              X