SEQanswers

Go Back   SEQanswers > Applications Forums > Genomic Resequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Questions for barcode file splitting, forward/reverse data sorting rzeng Bioinformatics 9 08-21-2013 01:15 PM
Questions for barcode file splitting, forward/reverse data sorting and .... rzeng Illumina/Solexa 0 08-19-2013 11:28 AM
how to define a forward or reverse read file poorphd Illumina/Solexa 3 11-22-2011 12:34 PM
Illumina1.8 Paired-End Barcode Splitting? pbatzel Bioinformatics 2 10-25-2011 02:08 PM
forward and reverse sequance asankaf General 5 05-27-2009 07:48 AM

Reply
 
Thread Tools
Old 08-19-2013, 12:53 PM   #1
rzeng
Member
 
Location: houston

Join Date: Aug 2013
Posts: 19
Default Questions for barcode file splitting, forward/reverse data sorting

HI, i am a pretty new for sequence analysis and totally new comer here. Anyone can help me? Very appreciate!!!

All I have are three fastq format separate raw data ( 40 million read sequences in each data), these are forward read data1, barcode read data2 and reverse read data 3. Each of the read sequence in three data are corresponding to each other with the same order (same ID) from beginning to the end. I have used a barcode file (6 different barcode) to split barcode data 2 into 6 separate files (by galaxy barcode splitter). Next, I need to get separate files for forward/reverse data by using this 6 separate files.

1. How can I get separate forward data1 and reverse data2 using my 6 separate barcode files. Is there software to do this? By the way, I do not have much bioinformatics background, any good suggestion?

2. How do I know where is the adapt sequences or if there are adapt sequences in the forward/reverse sequence from data 1 and 3 because this is very helpful for me to do adapt trim from original sequence?

following is just one example I extracted from my original data . All I have are only following 3 data with a separate barcode file. I do not have extra information like how is the barcode been designed, library construction or other..



Data 1 (forward read)

@IPAR1:2:1:4029:1196:1#0/1 ATTTTGCCACATACAAAAGAATCTACGTTCTTCTCAGCACCTCATGGAATCTTCTCTAAAATATATCATATAATAGGACACAAAAGAA
+ BHGHHHHHHHHGDDFHHHGGDGHFHFHHHHGD>GEEG>GFHHHHFHBBHFHHHHEHHHHHHBAFHHBBEHHHFEHGBECEHFHHFAHF


Data 2 (barcode read; TGACCTTG is the barcode tag and do not know yet what is ATCTCGT after tag)

@IPAR1:2:1:4029:1196:1#0/2
TGACCTTGATCTCGT
+
HIHIIGIIIH8CCDC


Data 3 (reverse read)

@IPAR1:2:1:4029:1196:1#0/3 GATATAATGGATGGGATTATTTCAATCTTTTATCTATTGAGGCTTCTTTTGTGTCCTATTATATGATATATTTTAGAGAAGATTCCAT
+ IIHIIIIHIIDEGGGEBG>GIIFIHHIHIIIIIFIDE4G@GG<GGEGBGG?AACCIIBIIBDIIIFDII>IIIIDIH@DFIGBI@IEE
rzeng is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:02 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO