SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimming left end (5') of reads?? blindtiger454 RNA Sequencing 23 01-11-2018 12:34 AM
Paired-end Illumina RNA-seq adapter trimming fabrice Bioinformatics 8 01-05-2015 07:48 AM
bwa quality trimming and samtools rmdup greigite Bioinformatics 7 02-22-2013 03:22 AM
can somene explain how BWA do its trimming foxyg Bioinformatics 7 12-19-2012 08:13 AM
BWA errors after quality trimming flipwell Bioinformatics 3 05-21-2012 07:39 PM

Reply
 
Thread Tools
Old 04-06-2011, 04:02 AM   #1
Yilong Li
Member
 
Location: WTSI

Join Date: Dec 2010
Posts: 41
Default Is there a but in BWA 3'-end trimming?

I got the following lines in the BAM file produced from BWA mapping using -q 6. It seems that the soft clipping in the CIGAR field is reporting one base less than should have been trimmed by the BWA trimming algorithm.

Code:
ILLUMINA-8C38E9_0111:3:99:15568:1908#0  83      1       9999977 60      32S50M  =       9999814 -213    GGCAGGGAGGTCCCTTGGGCCCAGGGTTTCCAGACCAGCCTGGCCGACACGGCGAAACCCCGTCTCTACAATAAATTAAAAT      #################################?:<?-?:445>-CA:@A??CDADA?=?BDEDEDEAEEEEEBEABEDE-E
ILLUMINA-8C38E9_0111:7:46:16510:9079#0  83      1       9999978 60      5S77M   =       9999740 -315    TACAGCCCAGCCTGGCCGACACGGCGAAACCCCGTCTCTACAATAAATTAAAATATTAGCTGGGCATGGTGGTGTGTGCTTG      ######?=C=CC@FDFEGBGEGGGGGFDBGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGFGGGGGGGGGGEG
ILLUMINA-8C38E9_0111:7:86:18250:3356#0  147     1       9999985 60      33S49M  =       9999455 -579    AGACCGTGTGACACCGGGAGTAACAGCCCAGCCGGGCCGACACGGCGAAACCCCGTCTCTACAATAAATTAAAATATTAGCT      ##################################B?CFFEFDGGGGGGGEGGGFGGGGFFGGGGGGFGFFGGGGGGGGGGGG
ILLUMINA-8C38E9_0111:3:37:15542:13225#0 99      1       10000237        50      71M11S  =       10000385        230     GTTTTTTGTTTGTTTTGAGACAGAGTCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGAGCAATCTCAGCTCACTGCAAGCC      GGDGGGGGGEDFGGGF@GGGGGGEGEGGGGGED?GDFEED>)=:5-662.0<:<5749.<81682:@?9@############
ILLUMINA-8C38E9_0111:3:53:3839:8121#0   99      1       10000270        51      81M1S   =       10000541        353     TGTCGCCCAGGCTGGAGTGCAGTGGAGCAATCTCAGCTCACTGCAAGCTCCGCCTCCCGGGCTCACACCATTCTCCTGCCCC      GGGGEGGGGGDGGFGGGEGGEFDFFFD?FFDEGGFDFFGGGGFGGGEABEEEDEACBE7-6%-23BABA5,:;;=?0-??##
Could somebody check your own BWA mapped BAM files to see if this is a general bug in BWA? Or is this a generally known feature?!
Yilong Li is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:25 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO