SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
"allele balance ratio" and "quality by depth" in VCF files efoss Bioinformatics 2 10-25-2011 11:13 AM
Relatively large proportion of "LOWDATA", "FAIL" of FPKM_status running cufflink ruben6um Bioinformatics 3 10-12-2011 12:39 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM
SEQanswers second "publication": "How to map billions of short reads onto genomes" ECO Literature Watch 0 06-29-2009 11:49 PM

Reply
 
Thread Tools
Old 07-19-2011, 09:12 AM   #1
medalofhonour
Member
 
Location: Brighton

Join Date: Jul 2011
Posts: 18
Default Using "Eland" format in Bowtie

Hello, I am new to Bowtie, so please pardon my naivety.

I have a reads file in the following format, which I suppose is the Eland format because this file has an "eland_result.txt" extension :

Example of one read record:

>HWI-EAS107_3:3:1:64:354 AAATAACTCTCCCCATTATTCTTGACCAACGTT U0 1 0 0 chr3.fa 89017297 R ..

When I run this reads file containing reads in the above format in Bowtie, I get the following output (error):

Time loading forward index: 00:00:12
Time loading mirror index: 00:00:13
Error: reads file does not look like a FASTQ file
Time for 1-mismatch full-index search: 00:00:00
Time searching: 00:00:25
Overall time: 00:00:25


Since I do not have the data in the FASTQ format, I don't think I have any other options.

Is there a way by which I can still use Bowtie with the file in the above format ?

Last edited by medalofhonour; 07-19-2011 at 09:26 AM.
medalofhonour is offline   Reply With Quote
Old 07-19-2011, 09:59 AM   #2
medalofhonour
Member
 
Location: Brighton

Join Date: Jul 2011
Posts: 18
Default

Or is it that the "eland_result.txt" file is already an alignment file ?
medalofhonour is offline   Reply With Quote
Old 07-19-2011, 08:02 PM   #3
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,177
Default

Quote:
Originally Posted by medalofhonour View Post
Or is it that the "eland_result.txt" file is already an alignment file ?
Bingo!

Now if you wanted to perform your own alignment using Bowtie you could just extract the read sequences from the eland_result.txt file to a FASTA file and run them through Bowtie. Since the eland_result.txt file does not contain the quality scores you can't make a FASTQ file (unless you just give mock qualities to every read).
kmcarr is offline   Reply With Quote
Reply

Tags
bowtie, eland, fastq, format

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:09 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO