An error about annotation exon number of gene in tophat-fusion report

[louis7781x]

I found an error about annotation gene.

In my result, one candidates report by tophat-fusion as follwing:

T2852 chr15-chr12 62173825 6979426 ff
6 1 6 2 35 41
TTACTGTACTCATTAAATCTTGTGATGACACTCACATCAATGAAAGGCTT AGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATG
00000000000000066666666666666666666666666666666666 66666666666666666666666666666666666666666000000000
VPS13C exon15(62173760-62173830) TPI1 exon7(6979427-6980109)

The error is that VPS13C express from genome revere site, the exon number is 71 instead of 15 (total exon number is 86).

exon number in genome:86<-85<-84.....71<--- (true)

exon number in genome:1->2->3->.....->15-> (error)

[angerusso]

messed up exon information from tophat-fusion

I also experienced similar problem with well known fusion.

Expected fusion in my sample is TMPRSS2(Exon1) with ERG. What I obtain is TMPRSS2 (exon14) with ERG which doesn't make sense.

Is there a solution to this problem? Please suggest how to get the right fusions from tophat-fusion?