
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
IGV - Genome problems tonio100680 Bioinformatics 7 01-12-2012 09:09 AM
some problems in using integrative genomics viewer magarine Bioinformatics 4 12-14-2011 04:25 PM
Dindel SAM/BAM format - viewing with IGV EHC General 0 10-06-2011 11:27 AM
Displaying DGE (bed-files) with Integrative Genomics Viewer Azazel Bioinformatics 1 09-01-2011 08:58 PM
Problems displaying SAM file in IGV gavin.oliver Bioinformatics 14 10-07-2010 04:56 AM

Thread Tools
Old 02-01-2013, 08:26 AM   #1
Location: spain

Join Date: Aug 2010
Posts: 10
Default Problems with displaying reads in SAM format in IGV - Integrative Genome Viewer

I have my doubts about the IGV displaying reads in sam-format correctly.

The reads in sam-format all have the same length (90) but appear like being of different lengths when I upload them in IGV. The same happend with the same file in BAM format.
I converted the SAM-file to a BED-file using Pyicos. Uploading this BED-file results into a correct display of the reads. See uploaded SAM-file (upper track) and uploaded BED-file (lower track) in attachment.
But when BED is displayed, I can obviously not see the actual sequences of the reads (to look for polymorphisms).

I am using the latest version of IGV: IGV_2.2.5

Did anyone see this issue as well and knows a way around it?

Below I give the SAM-file and the BED-file, as well as the command for the conversion.
Any help is highly appreciated!

# here the command to convert sam to bed:
pyicos convert input.sam output.bed -f sam -F bed

# here the SAM-file
ERR045703.5732207 99 19 16149684 60 75M15S = 16150110 508 AACGGGCACCCAGTGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGA B5@9FGGIFHHIIEFAFFHHKI@IKJIHG@EJJKIJKI?GGB>CGBHGJ@HEABAD?B@DCDC898?>GCGGBH################ X0:i:1 X1:i:0 XC:i:75 MD:Z:75 RG:Z:ERR045703 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR045704.58587335 163 19 16149690 60 37M53S = 16150123 494 CACCCAGGGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCTGTAGCGACTGTCCCCAAGTGAGCAGGGAGGGAAGCGAG @EC3<B=',EF/GBFE:7E<C->*416@A@8B;+$@###################################################### X0:i:1 X1:i:0 XC:i:37 MD:Z:7T29 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR045703.17024081 147 19 16149699 60 8S82M = 16149269 -511 ACCCAGTGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGC #########A=??=AFGD>?@37E=?9=:=4@@BBC=:=DA?CGADADGJKHJKJAFJJJFBGJGCGHEKIJIIGHHAHGGFGHDGCFC@ X0:i:1 X1:i:0 XC:i:82 MD:Z:82 RG:Z:ERR045703 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR045704.7021863 147 19 16149705 60 7S83M = 16149294 -493 GACCACTCGAGGATGCCCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCAC ########EEHGE?E?D<EFD>EEFDGEDFE?<BF?BFGIJKEIGG>IJJIGFHKHHFKHLJKJJIIIIJGIIJJHGGHGGDGCFEH@ X0:i:1 X1:i:0 XC:i:83 MD:Z:8A74 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR045704.32772245 163 19 16149726 60 90M = 16150187 499 AGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGT @EDFFFG?GEHIFGHIJHHIH@FFKJIHJJJJLIEFIKJKJKI?FHHJIFJEGEEGFCECHB=EEDFEFHFHHGFIH,:CGIHH>@EC<F X0:i:1 X1:i:0 MD:Z:90 RG:Z:ERR045704 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@A
ERR045704.57426661 163 19 16149741 60 90M = 16150165 492 AGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGTGCAGAGATGTGCCTC @EFEFF>HFHHGHGHIJ@GGGIIJJKKJGIBB??CHEJFFJHG@@DC>HIEGIJFC@FDCGFFHEIBFFGFGG=BBAEDJHHGIH;C?HD X0:i:1 X1:i:0 MD:Z:90 RG:Z:ERR045704 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@BB
ERR045704.56912904 147 19 16149756 60 13S77M = 16149309 -523 TAGCGACCGTCCCCAAGTCAGCAGCGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGTGCAGAGATGTGCCTCTC ##############AIEEFI>>43)<H@8FA9-GA02BD:46?E7ED<.6,.>1.=ECC,97E4C8ECA2'2-'EG<9,,;BHG=?GGD; X0:i:1 X1:i:0 XC:i:77 MD:Z:11G65 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
ERR045704.58477016 147 19 16149772 60 37S53M = 16149322 -502 CCACCCCGCAGCGACGGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCGGCCGTGCAGAGATG ######################################?F@?4DD9@IDG=5';GEC=(7C4HB8GHCIF<(C=&%%$4*GDGGA@4.D/ X0:i:1 X1:i:0 XC:i:53 MD:Z:38A14 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

# here is the BED-file
19 16149684 16149773 ERR045703.5732207 0 +
19 16149690 16149779 ERR045704.58587335 0 +
19 16149699 16149788 ERR045703.17024081 0 -
19 16149705 16149794 ERR045704.7021863 0 -
19 16149726 16149815 ERR045704.32772245 0 +
19 16149741 16149830 ERR045704.57426661 0 +
19 16149748 16149837 ERR045703.16563758 0 -
19 16149756 16149845 ERR045704.56912904 0 -
19 16149772 16149861 ERR045704.58477016 0 -
Attached Images
File Type: jpg IGV_issue.jpg (42.2 KB, 9 views)
sonja is offline   Reply With Quote
Old 02-01-2013, 09:32 AM   #2
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480

It looks like IGV is just not showing the soft-clipped regions. That would be the appropriate behaviour.
dpryan is offline   Reply With Quote
Old 02-01-2013, 10:17 AM   #3
Location: spain

Join Date: Aug 2010
Posts: 10
Default soft-clip

Thanks for your answer!
what are soft-clipped regions, please?
sonja is offline   Reply With Quote
Old 02-01-2013, 11:10 AM   #4
Richard Finney
Senior Member
Location: bethesda

Join Date: Feb 2009
Posts: 700

Can't find your 'S" ? 'S' operator documentation is here
See CIGAR 'S' (soft clip) operation in sam/bam format documentation at sourceforge :

As far as that recently added operator, don't 'X' me.
Richard Finney is offline   Reply With Quote
Old 02-01-2013, 11:15 AM   #5
Location: spain

Join Date: Aug 2010
Posts: 10

does it basically mean that the base quality is very low in these regions?
sonja is offline   Reply With Quote
Old 02-02-2013, 06:13 AM   #6
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480

Originally Posted by sonja View Post
does it basically mean that the base quality is very low in these regions?
In the case of your reads, at least, yes. You can see that from the quality scores (often #).
dpryan is offline   Reply With Quote
Old 02-02-2013, 08:25 AM   #7
Location: spain

Join Date: Aug 2010
Posts: 10

yes, thatīs exactly what I see!
Thanks a lot!!!
sonja is offline   Reply With Quote
Old 02-03-2013, 04:33 AM   #8
Jim Robinson
Location: Boston, MA

Join Date: May 2009
Posts: 75

You can optionally display the soft-clipped reads, its a user preference (View > Preferences > Alignments tab).
Jim Robinson is offline   Reply With Quote
Old 02-03-2013, 09:59 AM   #9
Location: spain

Join Date: Aug 2010
Posts: 10

great! I was looking for that... Thanks!!!
sonja is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 07:46 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO